ID: 1113698753

View in Genome Browser
Species Human (GRCh38)
Location 13:112366965-112366987
Sequence ACAAGGGAGGCAGCAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113698749_1113698753 -9 Left 1113698749 13:112366951-112366973 CCACCAGGATGGTGACAAGGGAG No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698739_1113698753 22 Left 1113698739 13:112366920-112366942 CCACCTGGTGGTAACAAGGCCAT No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698748_1113698753 -8 Left 1113698748 13:112366950-112366972 CCCACCAGGATGGTGACAAGGGA No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698734_1113698753 28 Left 1113698734 13:112366914-112366936 CCACCCCCACCTGGTGGTAACAA No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698744_1113698753 -4 Left 1113698744 13:112366946-112366968 CCTCCCCACCAGGATGGTGACAA No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698736_1113698753 25 Left 1113698736 13:112366917-112366939 CCCCCACCTGGTGGTAACAAGGC No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698738_1113698753 23 Left 1113698738 13:112366919-112366941 CCCACCTGGTGGTAACAAGGCCA No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698746_1113698753 -7 Left 1113698746 13:112366949-112366971 CCCCACCAGGATGGTGACAAGGG No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698737_1113698753 24 Left 1113698737 13:112366918-112366940 CCCCACCTGGTGGTAACAAGGCC No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698740_1113698753 19 Left 1113698740 13:112366923-112366945 CCTGGTGGTAACAAGGCCATTCT No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data
1113698742_1113698753 3 Left 1113698742 13:112366939-112366961 CCATTCTCCTCCCCACCAGGATG No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113698753 Original CRISPR ACAAGGGAGGCAGCAGGAAG TGG Intergenic