ID: 1113698791

View in Genome Browser
Species Human (GRCh38)
Location 13:112367126-112367148
Sequence ATGAGGGCAGAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113698777_1113698791 23 Left 1113698777 13:112367080-112367102 CCACCTGCTGCCAGCCGTGCAGA No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698776_1113698791 29 Left 1113698776 13:112367074-112367096 CCTGCTCCACCTGCTGCCAGCCG No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698783_1113698791 -5 Left 1113698783 13:112367108-112367130 CCCACCGTGCCAGTATCAATGAG No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698779_1113698791 20 Left 1113698779 13:112367083-112367105 CCTGCTGCCAGCCGTGCAGAGGA No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698787_1113698791 -9 Left 1113698787 13:112367112-112367134 CCGTGCCAGTATCAATGAGGGCA No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698780_1113698791 13 Left 1113698780 13:112367090-112367112 CCAGCCGTGCAGAGGAGCCCCAC No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698781_1113698791 9 Left 1113698781 13:112367094-112367116 CCGTGCAGAGGAGCCCCACCGTG No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698782_1113698791 -4 Left 1113698782 13:112367107-112367129 CCCCACCGTGCCAGTATCAATGA No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data
1113698784_1113698791 -6 Left 1113698784 13:112367109-112367131 CCACCGTGCCAGTATCAATGAGG No data
Right 1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113698791 Original CRISPR ATGAGGGCAGAGAGGGAAGC TGG Intergenic
No off target data available for this crispr