ID: 1113699504

View in Genome Browser
Species Human (GRCh38)
Location 13:112374263-112374285
Sequence TTTCTGCTGTGACCAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113699504 Original CRISPR TTTCTGCTGTGACCAAGCCC AGG Intergenic
901199564 1:7458847-7458869 TCTCTGCTGTGACCCAACCCTGG + Intronic
901323642 1:8354332-8354354 TCGCTGCTGTGACCAGGCCTCGG + Exonic
901917376 1:12510192-12510214 TTCCTGCTGGGAGCAAGGCCTGG + Exonic
902673517 1:17992578-17992600 TGTCTGCTGTGTGCCAGCCCAGG + Intergenic
903260549 1:22129552-22129574 TTCCTGCTGGGCCCATGCCCTGG + Intronic
903521225 1:23951685-23951707 TTTCTGCTGTGGCAAAATCCAGG + Intergenic
904338110 1:29810932-29810954 TGCCTGATGTGACAAAGCCCAGG + Intergenic
904835309 1:33331923-33331945 TCTCTGCTGTGACCTAGAGCTGG + Intronic
904978512 1:34477117-34477139 CTTCTGCTGTCAACAAGGCCAGG + Intergenic
905917077 1:41692342-41692364 TTTCTGGTGTTCCCAAGCACAGG + Intronic
906383521 1:45347815-45347837 GTTGAGCTGTGACCAAGTCCTGG + Intronic
912416595 1:109512468-109512490 TTTCTGCTGTGTCCAAGGCGTGG + Intergenic
913074554 1:115330897-115330919 TTTCTGCTGTGGCCCAGGTCAGG + Intronic
914644596 1:149641446-149641468 TTTCTGCTGTGAGCTAGAGCTGG + Intergenic
915632981 1:157166337-157166359 TTTCTGGTGGGAAAAAGCCCTGG - Intergenic
917455656 1:175183533-175183555 TTCCTGCTCTGCCCAGGCCCGGG - Intronic
917620089 1:176786694-176786716 CTTCTGCTGTGAGCAAACCTGGG + Intronic
919846461 1:201645650-201645672 ATTCTGCTGTGAGCAAAACCTGG - Intronic
920651611 1:207841738-207841760 GTTCTGCTGTGAGCTAGCTCTGG - Intergenic
922516702 1:226213245-226213267 TCTCTGCCGTGACCAGGGCCAGG - Intergenic
924037275 1:239950133-239950155 TTACTGCTGTGACCACACTCTGG - Intergenic
1063454418 10:6173205-6173227 TTTCTGCTGTGGAAATGCCCAGG - Intronic
1064506065 10:16031430-16031452 TTTCTGCAGTGTCCAAGCTCAGG - Intergenic
1065015345 10:21457583-21457605 TTTCTGCTGTGATTAGCCCCAGG - Intergenic
1065312305 10:24428188-24428210 TTTCTGCAGTGGCCTCGCCCAGG + Intronic
1066465546 10:35646936-35646958 TGTCTGCTGTCACCAGGCCAAGG + Intergenic
1067017639 10:42770011-42770033 TTTCTGCTGTACCCATTCCCAGG + Intergenic
1067551529 10:47239842-47239864 TTTCTGCTGTTAATAAGCCCAGG + Intergenic
1069815497 10:71191360-71191382 TTCCTGCTCTGGACAAGCCCTGG + Intergenic
1070745431 10:78930956-78930978 TTTCTACTTTGACCCTGCCCAGG + Intergenic
1070960054 10:80492452-80492474 TTGCTTCTGTGACCAATCCTAGG + Intronic
1071569647 10:86689985-86690007 TTGCTGCTGTGACCAAGACTGGG - Intronic
1071818266 10:89254183-89254205 CTTCTGCACTGACCTAGCCCAGG + Intronic
1072259829 10:93659130-93659152 TGTCTGCTATTACCAAGCCCTGG + Exonic
1073184391 10:101607066-101607088 TTGCTGTTGTGGCCAAGCCCTGG + Intronic
1074159780 10:110828057-110828079 TTTCTACTGAGAGCAAGCCTTGG - Intronic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1075489022 10:122850290-122850312 TTGCTGCTGTGGCCATACCCTGG - Intronic
1076058688 10:127396122-127396144 CTGCAGCTGTGACCTAGCCCAGG - Intronic
1076340343 10:129741171-129741193 TTTCTGCTGTGACCAGGGCTGGG - Intronic
1076879600 10:133233569-133233591 TTACTGCTGACAGCAAGCCCAGG + Intergenic
1077199796 11:1300679-1300701 TTTCTGCCTTGACAGAGCCCCGG + Intronic
1078907244 11:15699161-15699183 TTTTTGCTGGGAGCAAGTCCTGG - Intergenic
1084586594 11:70066084-70066106 TTTATTCCGTGACCCAGCCCCGG + Intergenic
1084690473 11:70722384-70722406 TTCCTGCAGTGACCAATCTCTGG + Intronic
1084774132 11:71364464-71364486 TTCCTGCTCTGGCCCAGCCCTGG + Intergenic
1085340469 11:75727965-75727987 TTTCTGATGTGACCAACCCTAGG - Exonic
1090477559 11:127037287-127037309 TGTCTCCTGAGACCAAGGCCAGG - Intergenic
1091708548 12:2718754-2718776 TTACTGGAGTGACCAAGCACTGG + Intergenic
1095465030 12:42481417-42481439 TTTCTTGTGTGAACATGCCCAGG + Intronic
1096299208 12:50411109-50411131 TTTCTACTGTAACAAACCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1101500834 12:105302205-105302227 TTTGGACTGAGACCAAGCCCAGG - Intronic
1102877093 12:116457218-116457240 TTTTTGCTGTGACCATGCGAGGG - Intergenic
1104997590 12:132668326-132668348 TTACAGCCGTGACCATGCCCAGG + Intronic
1110771654 13:79355557-79355579 TTTATGCTGTGAACAATCCTTGG - Intronic
1111700554 13:91682777-91682799 TGTCTGCTCTGACCAAGGGCAGG - Intronic
1112416804 13:99209551-99209573 TTTCTGCTGTAACCAGGCCTGGG + Intronic
1112705365 13:102061716-102061738 TGCCTTCTGTGACCAAGCACTGG - Intronic
1113699504 13:112374263-112374285 TTTCTGCTGTGACCAAGCCCAGG + Intergenic
1115465593 14:33711012-33711034 GTTCTGCTGGGAGCAAGCGCAGG + Intronic
1119711547 14:76826223-76826245 TGTCTACTGGGGCCAAGCCCAGG - Intronic
1119774825 14:77241811-77241833 ATTCTGCTGTAATTAAGCCCCGG - Intronic
1122790522 14:104182402-104182424 TTTCTGCTGGGACGCAGCGCTGG - Intergenic
1124359366 15:29024416-29024438 TCTCCGCAGTGACCAGGCCCTGG - Intronic
1125531737 15:40418101-40418123 TTTCTTCTCTGCCCAAACCCTGG + Intronic
1128268059 15:66284460-66284482 TGGCTGCTGTGATCAAGCCCAGG - Intergenic
1128879996 15:71234244-71234266 TTTCTACTGTTCCCCAGCCCAGG + Intronic
1129317155 15:74751936-74751958 TGCCTGCTGTGTGCAAGCCCTGG + Intronic
1129847943 15:78776679-78776701 TTCCTGCTGTGACCAGGCCCTGG - Intronic
1130093426 15:80839531-80839553 CTTCTGCTGTGAGGAAGGCCAGG - Intronic
1130253971 15:82317256-82317278 CTCCTGCTGTGACCGGGCCCTGG + Intergenic
1132660962 16:1061412-1061434 ATTCTGCTGGGACCAAGCACAGG + Intergenic
1133767511 16:8848277-8848299 CATCTGCAGTGACCCAGCCCAGG + Exonic
1134008876 16:10836500-10836522 TGGCTGCTGTGACAAAGGCCAGG - Intergenic
1134258450 16:12630772-12630794 TTTCTCCGGTGACCCAGCCCTGG - Intergenic
1134815997 16:17206467-17206489 CTTCTGCTGTGAACCAGCCACGG + Intronic
1135510497 16:23078695-23078717 TCTCTGCTGTGATAGAGCCCAGG + Intronic
1138431095 16:56969722-56969744 CCTCTGCTGAGGCCAAGCCCTGG - Intronic
1138454638 16:57114275-57114297 TTTCCTCTGGGGCCAAGCCCTGG - Intronic
1138528948 16:57624696-57624718 TGTCTGCTGTGACTGAGGCCTGG - Intronic
1139069758 16:63365737-63365759 ATTCTACTGGGACCAAGCTCAGG + Intergenic
1140145439 16:72302541-72302563 GTTCTGCTGTGTCCAGGCACCGG + Intergenic
1143039592 17:4023926-4023948 TTTCAGCTCTGATCCAGCCCTGG - Intronic
1143056901 17:4169345-4169367 TTCCTGCTGCCTCCAAGCCCTGG - Intronic
1144608670 17:16689840-16689862 TTGCTGCAGTGGCCAAGCCGGGG + Intergenic
1146948975 17:36892703-36892725 TTACTCCTGTGACTCAGCCCAGG + Intergenic
1151287515 17:73123719-73123741 TTCCTCCTTTGACCAAGCCCAGG + Intergenic
1151916581 17:77122763-77122785 TTGCTGCTCTGGCCAGGCCCAGG - Intronic
1152224893 17:79088173-79088195 TTTCAGCTGTGACCATTCCCGGG + Intronic
1152426816 17:80222543-80222565 TGTCAGCTGTGTCCAGGCCCAGG - Intronic
1154037788 18:10822545-10822567 TTTCTGCTAAGTCCCAGCCCTGG + Intronic
1157683912 18:49627903-49627925 ATTCTGATGTGGCCAATCCCTGG + Intergenic
1157966112 18:52210343-52210365 TTTCTTCTCTGATCAATCCCTGG - Intergenic
1160232412 18:77058266-77058288 TGCCTGCTGTGACCCAGCCTGGG - Intronic
1161560840 19:4971676-4971698 TTCCAGCTGTGACCAGGCCCTGG - Intronic
1163166646 19:15502665-15502687 TTTCAGCTGTTACCAGCCCCTGG + Intergenic
1163327383 19:16613890-16613912 TTGATTCTGTCACCAAGCCCAGG - Intronic
1165285040 19:34834589-34834611 TTGCTCCAGTGTCCAAGCCCCGG - Intergenic
1166703713 19:44896714-44896736 TCACTGCTGTGTCCCAGCCCAGG - Intronic
1167143183 19:47666224-47666246 TTCCTGCTGTGAGCATGCACAGG + Intronic
1167747080 19:51358166-51358188 GATCTGCTCTGGCCAAGCCCTGG - Intronic
927671060 2:25069243-25069265 TCGCTGCTGTGCCCAAGGCCTGG - Intronic
927963302 2:27254318-27254340 ATTCTCCTGCAACCAAGCCCAGG + Intronic
930238076 2:48906833-48906855 TTGCTGATGTGGCAAAGCCCAGG + Intergenic
931376731 2:61714479-61714501 TGTCTGCTGTGACCAAGGAATGG + Intergenic
931689571 2:64823643-64823665 TTTCTGCTTCAACCAAGTCCTGG - Intergenic
932585001 2:73022187-73022209 TGCCTGCTGTAAGCAAGCCCTGG - Intronic
933333639 2:80926401-80926423 TGTCTGCTGTGGGCATGCCCAGG + Intergenic
936528135 2:113256117-113256139 TCTGTCCTCTGACCAAGCCCTGG - Intronic
938289751 2:130142908-130142930 TTGCTGCTGTGGCCAGGCCCAGG - Intronic
938466775 2:131530030-131530052 TTGCTGCTGTGGCCAGGCCCAGG + Intronic
941934803 2:170974090-170974112 CTCCTGCTGTGCACAAGCCCGGG + Intergenic
943564314 2:189499267-189499289 ATTCTGCAGTGTCCAAGGCCTGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945635619 2:212346132-212346154 TATCTGCTGTGACAAAGAACTGG - Intronic
945965800 2:216185159-216185181 TTCTTGCTGTTACCAATCCCGGG + Intronic
946488799 2:220127526-220127548 TTTCTGCTGTTACTAATCCCTGG + Intergenic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1168963015 20:1881642-1881664 TTCCTGCTGGGACACAGCCCAGG + Intergenic
1168975779 20:1964820-1964842 TGTCTCCTTTGACCAAACCCCGG - Intergenic
1170321630 20:15105718-15105740 TTTCTGCTGTCTCTAAGTCCAGG - Intronic
1170616503 20:17956726-17956748 ATTCTGCTGTGGCAGAGCCCTGG - Intronic
1172464086 20:35142598-35142620 CTTCTGCTGTCACCAATCCTAGG - Intronic
1172880234 20:38195085-38195107 TTTCTGCTCTGACAAAGGTCAGG + Intergenic
1172943563 20:38671279-38671301 TCTCTGCTGTGACTCAGCCACGG + Intergenic
1174747311 20:53076238-53076260 TTTCTGCTGTCATCCAGTCCAGG - Intronic
1176044187 20:63083918-63083940 TTCCTGCTGTCAGGAAGCCCCGG - Intergenic
1176241076 20:64076220-64076242 ATGCTGCTGTGAGCCAGCCCAGG - Intronic
1177831877 21:26148306-26148328 TTTCAGCGGTGACCAGGCACTGG - Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178314373 21:31557093-31557115 ATTCTGCTGGGACCCAGACCTGG - Intronic
1179802437 21:43817270-43817292 TTTCTCCTGGGGCCCAGCCCTGG + Intergenic
1180096480 21:45557584-45557606 TTTGTGCAGTGACCAGGACCAGG + Intergenic
1180189994 21:46158348-46158370 TCTCAGCTGTAGCCAAGCCCTGG - Intergenic
1180966252 22:19789324-19789346 ATTCTGCTGCCATCAAGCCCGGG - Intronic
1182451852 22:30426454-30426476 TTACTCCTGGGACCAAGACCAGG + Intronic
1183132708 22:35854673-35854695 GTTCTGCTGAAACCATGCCCAGG + Intronic
951025500 3:17824361-17824383 CTTAAGCTGTGACCAAGCCAGGG - Intronic
952252290 3:31666251-31666273 TTTCTGCTCAGACCAAGCTCTGG + Intronic
953303234 3:41800200-41800222 TTTCTCCTGTAATAAAGCCCTGG + Exonic
961497742 3:127306601-127306623 TGGCTGCTGTGACAAAGCCCAGG - Intergenic
961768087 3:129227971-129227993 TTTCTGCTGTGAATGAACCCAGG + Intergenic
963309974 3:143699559-143699581 TTTCTGCTGTGACACGGCACCGG - Intronic
966258960 3:177952528-177952550 TTTCTGCCCTGCCCATGCCCTGG + Intergenic
966357433 3:179096069-179096091 TTTCTCCTGGAACAAAGCCCAGG + Intergenic
968448642 4:664907-664929 TGTCTGCCATCACCAAGCCCTGG + Exonic
968532983 4:1105001-1105023 TGTCTGCTGTCTCCAGGCCCTGG + Intronic
968803501 4:2757688-2757710 CTTCTGCTGAGAGGAAGCCCAGG - Intergenic
968840396 4:3000467-3000489 TTTCTGCTGTGTCCAGTGCCTGG + Intronic
969526999 4:7708933-7708955 TTCCTGCTCTGGCCAGGCCCTGG + Intronic
974694745 4:65351780-65351802 TATCTGCTTTGACCAAGCAGAGG - Intronic
975402243 4:73951707-73951729 TTTGGACTGAGACCAAGCCCAGG + Intergenic
976579863 4:86723275-86723297 CTCCTGCTGTGACCAGGCCATGG - Intronic
979310811 4:119201118-119201140 TTTCTGAAGAGACCAATCCCAGG + Intronic
980230887 4:130045280-130045302 TTTCTGCTGTGGCTGACCCCTGG - Intergenic
980949558 4:139359787-139359809 TGTCTGCTGTGTCCAAGGCCTGG - Exonic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982082562 4:151805075-151805097 ATTCTGCTGGGATCCAGCCCAGG + Intergenic
984168455 4:176332255-176332277 TTTCTAATGTGACCAAACCATGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987822800 5:22987463-22987485 TTTCTGTTGTGACCTACCACAGG - Intergenic
988093973 5:26578887-26578909 TTGCAGCTGTCATCAAGCCCAGG + Intergenic
991064868 5:62413978-62414000 TTTCTGCAGTAACCTAGCACAGG + Intronic
998093734 5:139385225-139385247 TCTCTGATCTGGCCAAGCCCTGG - Intergenic
1001744917 5:174085011-174085033 TTTCTGCTCTGATCAAACCATGG + Intronic
1003517979 6:6833672-6833694 TCTCTGATGTGAGTAAGCCCTGG - Intergenic
1004276143 6:14236620-14236642 TTCCTGCTCTGACCAAGCCCAGG - Intergenic
1004464620 6:15873137-15873159 ATTGTGCTGTGAGGAAGCCCAGG + Intergenic
1004520860 6:16359368-16359390 TGCCTGCTGTGGCTAAGCCCAGG - Intronic
1006772077 6:36561988-36562010 TTGCTGCTCTGGCAAAGCCCAGG - Intergenic
1010056202 6:71568290-71568312 TTTCAGCTGTGTCCAACCCTTGG + Intergenic
1010611047 6:77954022-77954044 TGTCTGCTGTGCCCAAGCAGAGG - Intergenic
1011498408 6:87961608-87961630 TTTCTCCTGTGACCAAGCCTAGG + Intergenic
1013285221 6:108675420-108675442 CTGCTGCCTTGACCAAGCCCAGG + Intronic
1016295312 6:142567053-142567075 TTCCAGATGTGACCAACCCCTGG + Intergenic
1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG + Intronic
1027262090 7:76471919-76471941 GTTCTGCTCTGACCTATCCCTGG + Intronic
1027313471 7:76970014-76970036 GTTCTGCTCTGACCTATCCCTGG + Intergenic
1027668419 7:81067972-81067994 TATCTGCTGAGAACAATCCCTGG - Intergenic
1031464182 7:122088138-122088160 TTTCTGCTCTGACAATGCTCAGG + Intronic
1032329106 7:130961181-130961203 TTACTGCTGAGCCAAAGCCCAGG + Intergenic
1032674168 7:134113175-134113197 TTCCTGCTGTGGCTAGGCCCCGG - Intergenic
1035444109 7:158928105-158928127 CTTCTGCTCTGCCCAAACCCGGG - Intronic
1035585862 8:773076-773098 TGGCTGCTGTAACCAAGCCCTGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036821416 8:11942842-11942864 TGTGTGCTGTGATCAAGCTCTGG - Intergenic
1037432372 8:18827328-18827350 TGTCTTCTGTGACCTATCCCTGG - Intronic
1039378845 8:37065873-37065895 TTTCTTCCTTGACCAGGCCCTGG - Intergenic
1040379795 8:46861359-46861381 TGTCTCCTGTGACAGAGCCCAGG - Intergenic
1041934878 8:63323493-63323515 TGTCTGCTGTGGGCATGCCCAGG - Intergenic
1043265670 8:78265285-78265307 ATTCTGTTGTGCCCAAACCCTGG - Intergenic
1046138400 8:110060630-110060652 TTTCTACTGGGACCTGGCCCAGG + Intergenic
1047926746 8:129689644-129689666 TATCTGCTCTGACCCAGCTCTGG + Intergenic
1048074134 8:131050632-131050654 CTTCTGCTGTTACCAAGCACTGG - Intergenic
1048788834 8:138081519-138081541 TTTCTGCTTTTACCAAGGTCAGG - Intergenic
1049698531 8:143995440-143995462 TATCTGCTGTGTCCCAGCCAGGG + Intronic
1051399624 9:16665711-16665733 TTTCCTCTGAAACCAAGCCCTGG + Intronic
1053413081 9:37928288-37928310 ATTTTGCTGTCCCCAAGCCCAGG - Intronic
1055397094 9:75887863-75887885 TTCCTTCTGTGAGCATGCCCTGG - Intergenic
1057406078 9:94771836-94771858 TTACTGCTGTGGCTAATCCCTGG + Intronic
1058756435 9:108086929-108086951 TTCCTCCTGTGACCAGGACCTGG + Intergenic
1060266584 9:122115223-122115245 TCTCTGCTCTCACCAAGACCTGG - Intergenic
1061419533 9:130465921-130465943 TGTCTGCAGAGGCCAAGCCCAGG + Intronic
1061885299 9:133588198-133588220 TTTCTGCTGAGACCGAGTCGGGG + Intergenic
1062090573 9:134676471-134676493 TTGCTGCTGTGAGCAAGCCTTGG + Intronic
1062357676 9:136172559-136172581 TTTCTGGTGTGCCGCAGCCCTGG + Intergenic
1062652921 9:137587497-137587519 TTTCTGCTGGGAGCTTGCCCAGG - Intronic
1187197858 X:17105294-17105316 ATTTTGTTGTGACCAAGTCCAGG - Intronic
1187704196 X:21993466-21993488 TATCTGCTGTTGCCAAGTCCAGG + Intronic
1190421847 X:50292865-50292887 TGTCTCCTTTGTCCAAGCCCTGG + Intronic
1190628102 X:52355921-52355943 TTTCTCCTGTGCCCCAGCCTGGG - Intergenic
1192273288 X:69604791-69604813 TATCTGCTGTGAACAAGTCGGGG - Intergenic
1194181539 X:90716344-90716366 TTTCTGCTGTGAGAAAGATCTGG - Intergenic
1194218819 X:91167003-91167025 GTTCTGCTGTAACCACGACCTGG + Intergenic
1197698369 X:129575599-129575621 TTCATCCTGTGACCAAGTCCTGG - Intronic
1200528164 Y:4298259-4298281 TTTCTGCTGTGAGAAAGATCTGG - Intergenic
1200555329 Y:4630757-4630779 GTTCTGCTGTAACCACGACCTGG + Intergenic
1200852924 Y:7904185-7904207 TGTCTGCTTTTGCCAAGCCCAGG + Intergenic