ID: 1113705096

View in Genome Browser
Species Human (GRCh38)
Location 13:112425148-112425170
Sequence TCCGGGCGCCCACGCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113705096_1113705109 22 Left 1113705096 13:112425148-112425170 CCACAGTGGCGTGGGCGCCCGGA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1113705109 13:112425193-112425215 CCTGCAGGGTGACATAGGCCAGG 0: 1
1: 0
2: 9
3: 15
4: 219
1113705096_1113705104 8 Left 1113705096 13:112425148-112425170 CCACAGTGGCGTGGGCGCCCGGA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1113705104 13:112425179-112425201 TGCGCACAGGCTCCCCTGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 166
1113705096_1113705105 17 Left 1113705096 13:112425148-112425170 CCACAGTGGCGTGGGCGCCCGGA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1113705105 13:112425188-112425210 GCTCCCCTGCAGGGTGACATAGG 0: 1
1: 1
2: 3
3: 22
4: 247
1113705096_1113705101 -5 Left 1113705096 13:112425148-112425170 CCACAGTGGCGTGGGCGCCCGGA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1113705101 13:112425166-112425188 CCGGATCCAAGGGTGCGCACAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1113705096_1113705103 7 Left 1113705096 13:112425148-112425170 CCACAGTGGCGTGGGCGCCCGGA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1113705103 13:112425178-112425200 GTGCGCACAGGCTCCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113705096 Original CRISPR TCCGGGCGCCCACGCCACTG TGG (reversed) Intronic
900116953 1:1033063-1033085 TCCGGGCCCTGACGTCACTGCGG - Intronic
903263887 1:22145000-22145022 TCTGGGTGCCCAGGCCCCTGGGG - Intergenic
905638922 1:39575719-39575741 TCCGGGCTCCCACGCACGTGTGG + Intronic
908951642 1:69568534-69568556 CCCTGGCGCCCACTCCACTGCGG + Intronic
922693554 1:227713645-227713667 CTCGGGAGCCCACGCCACTGGGG + Intergenic
923631102 1:235649930-235649952 TCTGGGCCCCCACGGCACAGGGG - Exonic
1063613116 10:7579984-7580006 TCCGGTCTCCAATGCCACTGTGG + Exonic
1066508144 10:36066428-36066450 TCCTGGTGCCCACTCCAGTGTGG + Intergenic
1067369760 10:45672548-45672570 GCCGAGCGCCCGCGCCACTCCGG + Intronic
1070140236 10:73733151-73733173 GCCGCGCGCCCACGGCCCTGCGG + Intergenic
1076830333 10:132991296-132991318 TCCTGGCGCCCACCTCCCTGGGG + Intergenic
1077042182 11:529754-529776 TCCCGGCACCCAGGCCTCTGCGG + Intergenic
1077464419 11:2726826-2726848 ACCTGGCGCCCATGCCAGTGGGG - Intronic
1081011060 11:37812638-37812660 TCCGGGTGCTCACTCCAGTGTGG - Intergenic
1089505070 11:118957231-118957253 TCCCTGCGCCCACGGCACGGAGG - Exonic
1090231946 11:125113683-125113705 TCCGGGAGCCCAAGCCCCTGAGG - Intergenic
1092256337 12:6928321-6928343 TCCGGGCTCCGGCGCCTCTGGGG - Intronic
1104889741 12:132134566-132134588 TCCAGGCCCCCGTGCCACTGTGG + Intergenic
1104931566 12:132341911-132341933 CCCGGGCGCCCACTGCAGTGAGG - Intergenic
1106243613 13:27928561-27928583 TCCGAGCGCCCTCGCCCCTCAGG - Intergenic
1113705096 13:112425148-112425170 TCCGGGCGCCCACGCCACTGTGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1126502920 15:49366763-49366785 CCCGGCCGCCCCCGCCACGGAGG - Intronic
1131826040 15:96323027-96323049 TCCGCCCGCCCACACCTCTGAGG + Intergenic
1139923029 16:70471412-70471434 TCCTGGCCCCCACCCCACTGCGG + Intronic
1143527102 17:7479264-7479286 CCCGGGCGCGCACGACGCTGGGG - Intronic
1146124809 17:30223022-30223044 TCCCTGCGCCCAGGCCACGGCGG - Intronic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1147341389 17:39754859-39754881 TCCCGCCGCCCACGCCGCTCGGG - Intergenic
1152758901 17:82098277-82098299 CCCGGGCGGCCACGCCACATGGG + Exonic
1153608086 18:6854874-6854896 TCCTGGCTCCCACTCCAGTGTGG + Intronic
1159997617 18:74981285-74981307 TCCGGCTGCCCAGGGCACTGCGG - Intronic
1160860436 19:1235219-1235241 TCCGGGCGGCCACGGCAGGGAGG + Intronic
1165994261 19:39833317-39833339 GCCGCTCGCCCACCCCACTGGGG - Exonic
1166225233 19:41391021-41391043 TCAGGGCGCCCCCAGCACTGAGG + Intronic
1168345485 19:55648504-55648526 TCCGCCCGCCCACGCGAGTGCGG + Exonic
1168691646 19:58381012-58381034 TCCGGGCCGCCGCGGCACTGAGG + Exonic
925011525 2:488997-489019 TCCGGGCACCCTCCTCACTGAGG + Intergenic
925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
925170517 2:1747476-1747498 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
925224469 2:2171077-2171099 TCCCGGCGGACACTCCACTGAGG + Intronic
927552075 2:24009862-24009884 TGCGGGCGCTCACGCCCCCGGGG + Intergenic
931517631 2:63059222-63059244 CCCGGGTGCCCAGGCCAGTGCGG - Intergenic
935667483 2:105525325-105525347 TCCTGGTGCCCACTCCAGTGTGG + Intergenic
937991635 2:127665395-127665417 ACCAGGCCCACACGCCACTGAGG + Intronic
942123482 2:172801460-172801482 TCCTGGCTCACACCCCACTGAGG - Intronic
942678233 2:178450843-178450865 GCCCGGCGCCCACGCCTCCGCGG - Intronic
947588228 2:231370141-231370163 GCCAGGCTCCCACGCCAGTGGGG - Intronic
948207108 2:236168176-236168198 CCCGGGCGCCCTCTCCACTCCGG - Exonic
1169474987 20:5923188-5923210 TCCAGGCGTCCAGGCCCCTGAGG + Exonic
1180074560 21:45456061-45456083 TCCGGGCGCCCACACAACCGAGG + Exonic
1183380656 22:37489061-37489083 TCCGGGCCTCCACTCCACAGGGG + Intergenic
950509884 3:13419849-13419871 TCCGGGCCTCCGCGCCGCTGAGG - Intronic
951566943 3:24020253-24020275 TCCCAGCGCCCACTCCACAGTGG - Intergenic
954392195 3:50273697-50273719 TCCGGGAGCCCCCGCCGCAGCGG + Intronic
964282357 3:155080163-155080185 TCCGAGCGCCCAGGACCCTGCGG + Intronic
965590631 3:170357630-170357652 TCGGCCCGCCCACGTCACTGCGG - Intergenic
966912287 3:184566243-184566265 TCCATGCCCCCACCCCACTGTGG - Intronic
969456798 4:7304898-7304920 TCCTGGGGGCAACGCCACTGAGG + Intronic
974326351 4:60419497-60419519 TCCGGGTGCCCACACCACCAGGG - Intergenic
985881282 5:2640833-2640855 CCCGGGTCCCCAGGCCACTGGGG + Intergenic
994451504 5:99950309-99950331 TCCTGGCGCCCACTCCAGTGTGG + Intergenic
1010283012 6:74041729-74041751 CTCGGGAGCCCACACCACTGGGG - Intergenic
1013404982 6:109835051-109835073 TCTGGGCGCTCACGGCACTTCGG + Intergenic
1015590989 6:134823013-134823035 TCCAGGCTCTCACGCCTCTGTGG + Intergenic
1015999630 6:139029438-139029460 TCGGGGCGCCCGGGCCACGGGGG + Intronic
1027048030 7:75004041-75004063 TCCCGGCGCCCTCGGCTCTGAGG - Intronic
1029384967 7:100237574-100237596 TCCCGGCGCCCTCGGCTCTGAGG + Intronic
1030692243 7:112547441-112547463 TCCGTGAGCCCACGCCACCAGGG - Intergenic
1038773113 8:30502449-30502471 TCCTGTGGCCCAGGCCACTGGGG - Intronic
1043171589 8:76972830-76972852 TCTTGGCCCCCACCCCACTGGGG + Intergenic
1049164606 8:141118182-141118204 TCCCGGCACCTACACCACTGGGG + Intronic
1049651673 8:143772490-143772512 TCCCGGGGCCCACACCTCTGGGG - Intergenic
1049694300 8:143976107-143976129 TCCCGCGGCCCACGCCGCTGCGG - Intronic
1055750655 9:79501144-79501166 TCCTGTGGCCCAGGCCACTGTGG - Intergenic
1062427485 9:136512615-136512637 TCCCGGCGCCCACCCTGCTGGGG - Intronic
1062442739 9:136578453-136578475 GCCGGGCGCCCCCACCGCTGTGG + Intergenic
1188727842 X:33607314-33607336 TCCCGGTGCCCACTCCAGTGTGG - Intergenic
1193091032 X:77494190-77494212 TTCGTGAACCCACGCCACTGGGG + Intergenic