ID: 1113705680

View in Genome Browser
Species Human (GRCh38)
Location 13:112431593-112431615
Sequence AGAAATGAGACTGAGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113705673_1113705680 20 Left 1113705673 13:112431550-112431572 CCTGCTAGGTGCTCGGCAGATAT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1113705680 13:112431593-112431615 AGAAATGAGACTGAGGGGTCAGG 0: 1
1: 0
2: 2
3: 24
4: 353
1113705671_1113705680 29 Left 1113705671 13:112431541-112431563 CCTGCTGAGCCTGCTAGGTGCTC 0: 1
1: 0
2: 3
3: 12
4: 206
Right 1113705680 13:112431593-112431615 AGAAATGAGACTGAGGGGTCAGG 0: 1
1: 0
2: 2
3: 24
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113705680 Original CRISPR AGAAATGAGACTGAGGGGTC AGG Intronic
900032156 1:379982-380004 TGAAATGGGAGTGAGGGGTGAGG + Intergenic
900052706 1:608168-608190 TGAAATGGGAGTGAGGGGTGAGG + Intergenic
901272530 1:7963668-7963690 AGAAACGAGTCTGAGGGGCCGGG - Intronic
901317571 1:8318983-8319005 AGAAAGAAGCATGAGGGGTCGGG + Intronic
902365305 1:15969392-15969414 AGAAAGGGGGCTGAGGGGTGGGG - Intronic
902713335 1:18255541-18255563 AGAAATGAGAGTGAGGAGTGTGG - Intronic
903667216 1:25015460-25015482 AGAAATCAGGCTGGGGGCTCAGG - Intergenic
904318569 1:29681771-29681793 AGAAAAGAGAATGAGGGGTCGGG + Intergenic
905224258 1:36468854-36468876 AGAAATTGGACAGAGGGGCCGGG - Intronic
906029722 1:42708885-42708907 AAGAATGAAACTGAGGGGCCAGG - Intergenic
906035606 1:42748625-42748647 GGAAGTGAGAATGAGGGATCAGG + Intronic
906300594 1:44678605-44678627 AGAACTGAGAGTTAGGAGTCAGG + Intronic
907618237 1:55947410-55947432 AGCATTGAGACTGAGGGATTGGG - Intergenic
909121428 1:71609218-71609240 AGAAATGAGACTGTATGGCCGGG + Intronic
912510259 1:110184922-110184944 GAAAAGGAGACTGAGGGATCGGG + Intronic
913196275 1:116458799-116458821 AGAAATGAGTGTGTGGGGTATGG - Intergenic
913479279 1:119270981-119271003 AGAACAGAGAGTGAGGTGTCAGG + Intergenic
914810327 1:151023059-151023081 AAAGATGAGACAGAGGGGGCAGG + Intronic
915489327 1:156242636-156242658 GGGAATGAGACTGAGGGACCAGG - Intronic
916064146 1:161122503-161122525 AGACATCAGACTGCGGGTTCGGG - Exonic
916225863 1:162489034-162489056 AGAAATAGAACTGAGGGGCCGGG - Intergenic
918849026 1:189659517-189659539 AAAAATGAGGCTGAGGAGTCTGG - Intergenic
919139299 1:193550687-193550709 AGAAAAAAGAGTGAGGGCTCTGG - Intergenic
920193781 1:204212804-204212826 AGGGATGTCACTGAGGGGTCAGG - Intronic
920290581 1:204920349-204920371 AGCAATTAGACTGTGGTGTCAGG + Intronic
920378686 1:205523288-205523310 CGGAATGAGAGTGAGGGGTCTGG + Exonic
922595425 1:226809373-226809395 AGAGATGAGACAGTGTGGTCTGG - Intergenic
922872014 1:228910496-228910518 AGAAATGCAACTGAGAGGGCCGG - Intergenic
922990658 1:229908240-229908262 AAAAATGAGAATGAGGGGGACGG - Intergenic
923287826 1:232514081-232514103 AGAAATGAGACTGGAGGGGAAGG - Exonic
923485276 1:234423723-234423745 AGAAAAAAGAGAGAGGGGTCAGG - Intronic
1063962056 10:11314817-11314839 GGAAATGAAACTGAGGGGAGAGG + Intronic
1064402591 10:15033975-15033997 GGAAAAGAGACTGATGGGTTAGG + Intronic
1065839443 10:29689262-29689284 AGAAAAGAGACTCATGAGTCGGG - Intronic
1065843484 10:29725680-29725702 AGAAAGGAGGCAGAGGGCTCTGG + Intronic
1066253685 10:33657763-33657785 GGAAATGAGACAGAGCTGTCAGG + Intergenic
1066408670 10:35144398-35144420 AGAAATAAAAGAGAGGGGTCAGG + Intronic
1068668529 10:59701067-59701089 AGAATTGAGTTTGAGGGGCCTGG - Intronic
1071295899 10:84219429-84219451 GCACATGAGACAGAGGGGTCAGG - Intronic
1071333876 10:84586226-84586248 AAAAAGGAGAGTAAGGGGTCAGG - Intergenic
1072753915 10:98004541-98004563 AGAAATGGAACTGCAGGGTCAGG - Intronic
1072910050 10:99492454-99492476 ACAAATGAGACTGAAAGGTCAGG + Intergenic
1073121954 10:101127395-101127417 AAAGATGAGACTGGAGGGTCAGG - Intronic
1073134762 10:101214302-101214324 AGAAGTGAGGGTGAGAGGTCGGG + Intergenic
1073245719 10:102088626-102088648 AGAAATGAGATTGGGTGGGCTGG - Intergenic
1075160317 10:120018720-120018742 AGAATTGAGGCTGAGGCGTAAGG - Intergenic
1076785571 10:132748187-132748209 AGCAAGGAGACTGCGGGGGCCGG - Intronic
1079119789 11:17673656-17673678 AGAATGGAGACTGAGTGATCAGG - Intergenic
1079130902 11:17746437-17746459 AGAAGTCAGACTCGGGGGTCGGG - Intronic
1082802156 11:57423076-57423098 AGAAAGAAGAGTGAGGGATCAGG + Intronic
1083178924 11:60971964-60971986 AGAAAGGGGACTGAGAGGGCCGG - Intronic
1083288877 11:61679155-61679177 GGAAATGAGACTGTGAGGCCAGG - Intergenic
1083947337 11:65931477-65931499 AGAAATTAGACTGGAGGGCCTGG - Intergenic
1085720322 11:78906732-78906754 GGAAATGAAAATGAGAGGTCTGG - Intronic
1085756625 11:79207112-79207134 GGCAATGAGCCTGTGGGGTCGGG + Intronic
1086902474 11:92383354-92383376 AGTAATGGGACTGCTGGGTCAGG + Intronic
1087563000 11:99815353-99815375 AGAACTAAGACTGAGGAGTGGGG + Intronic
1087810067 11:102600861-102600883 AGAAAAGGGACTGAGTGGCCAGG - Intronic
1088721734 11:112598394-112598416 AGTAATGAGATTGTTGGGTCAGG - Intergenic
1089632077 11:119790111-119790133 AGGAATGAGTGTGAGGGGGCTGG - Intergenic
1090069895 11:123534923-123534945 AGAAATCAGACTGAGGGCCTTGG + Intronic
1090133639 11:124171309-124171331 AAAAATGAGACTGAGAGCTTGGG + Intergenic
1090155449 11:124432779-124432801 AGAAATGAGACAGATGGGACTGG + Intergenic
1091945665 12:4539006-4539028 AGACATGAGACTAAGGGGAAAGG + Intronic
1092257276 12:6934223-6934245 AGAACTGAGATCGAGGGGCCGGG + Exonic
1093572263 12:20680160-20680182 AAGAGTGCGACTGAGGGGTCTGG - Exonic
1093863615 12:24198240-24198262 AGAAAGGAGAGGGAGGGGTTGGG + Intergenic
1093913608 12:24775140-24775162 TCAAAGGAGTCTGAGGGGTCAGG - Intergenic
1095342356 12:41106528-41106550 TGAGATGTGACTGAGGGGCCAGG - Intergenic
1095513995 12:42985531-42985553 AGAAATGAGTCTAAGGGATAAGG + Intergenic
1095689971 12:45076698-45076720 AGAAAGGAGACTGAGGAGCTAGG + Intergenic
1096360811 12:50984582-50984604 AGAAATGAGACTAAATGGCCTGG + Intronic
1096492577 12:52020836-52020858 AGAAAGGAAGCTGAGGGCTCTGG + Intergenic
1098890285 12:76003603-76003625 AGAAATCAGTCTGGGGGGTGGGG + Intergenic
1100426966 12:94496594-94496616 AGAAATGAGACTCAAGGATGTGG - Intergenic
1100604039 12:96136373-96136395 ATAAGTGAGACAGAGTGGTCTGG - Intergenic
1101262697 12:103048815-103048837 AGAACTGAGAATGAGGGATAAGG - Intergenic
1102534107 12:113568203-113568225 AGAAACTAGACTTAGGGGGCTGG - Intergenic
1102882649 12:116497557-116497579 AGAAATGTGGCTAAGGGGCCAGG - Intergenic
1102984012 12:117264247-117264269 TGAAATGAGAGTGAGTAGTCAGG - Intronic
1103046761 12:117742211-117742233 TTAAAGGAAACTGAGGGGTCAGG + Intronic
1103116488 12:118338013-118338035 AGAAATAATACTGAGAGGTCGGG - Intronic
1103837001 12:123829596-123829618 AGAACTGAAACTGAAGGGTAAGG - Intronic
1104183335 12:126403992-126404014 AGAAACGAGAGTGAGGGGTGGGG + Intergenic
1105655514 13:22433256-22433278 AGAAATGAGAGAGAGGACTCAGG + Intergenic
1105809586 13:23983091-23983113 AAAAATGGGAGTGAGGGGTTGGG + Intronic
1106301341 13:28469018-28469040 AGAAGAGAGACTGAGGGATGAGG - Intronic
1106372491 13:29149048-29149070 AGTAATGAGACTGCTGGATCGGG + Intronic
1107715327 13:43193956-43193978 AGAAACAAGTCTGAGGTGTCTGG + Intergenic
1108530630 13:51324210-51324232 AGAGCTGAGACTCAGGAGTCAGG + Intergenic
1109359690 13:61280047-61280069 AAAATTGAGACTGAGGAGTGGGG + Intergenic
1109429004 13:62207617-62207639 AGACATGTGAATGAGGGATCTGG - Intergenic
1110519274 13:76456244-76456266 GGAAATGAGACTGTGGGGGAAGG + Intergenic
1111886694 13:94030302-94030324 AAAAAAGAGACAGAGGGGACGGG - Intronic
1113705680 13:112431593-112431615 AGAAATGAGACTGAGGGGTCAGG + Intronic
1114361786 14:21982372-21982394 AGAAATGGCACTGATGGGCCTGG + Intergenic
1115417523 14:33153613-33153635 AGAAATGAGGGTGGGAGGTCTGG - Intronic
1115867163 14:37760459-37760481 AGAAAGGAGGCACAGGGGTCAGG + Intronic
1118331311 14:64818017-64818039 TGAGATGAGGCTGAGGGGTGAGG - Intronic
1118885659 14:69863938-69863960 AGCCATGAGAATGAGGGGTATGG + Intronic
1119715169 14:76853965-76853987 AGACAGGAGACTGAGGGGCTGGG - Intronic
1120094616 14:80374666-80374688 AGAAATGAGAGTGCCGGGTGTGG - Intronic
1121232716 14:92369479-92369501 AGAAAGGAGACTGTGGAGACAGG + Intronic
1121413660 14:93764188-93764210 AGAGATGAGCCAGAGGGGTGAGG - Intronic
1122920066 14:104876396-104876418 AGAACTGAGAGGGAGGGGCCAGG - Intronic
1122920085 14:104876454-104876476 AGAACTGAGAGGGAGGGGCCAGG - Intronic
1123926788 15:25121263-25121285 AGAAATGAGGCTTTGGGGTCTGG + Intergenic
1125199802 15:37093408-37093430 AGAAATGAAAATGAAGGGTATGG + Intronic
1125670308 15:41467416-41467438 AGAAAGGATACTGTGGGGGCCGG + Intronic
1127389490 15:58493963-58493985 AGAAATGAGAGTAGGGGTTCTGG + Intronic
1127604597 15:60573766-60573788 ACAAATCAGACTGAGGGGTTAGG - Intronic
1128077691 15:64838236-64838258 AGAAAAGAGATAGAGGGATCAGG - Intergenic
1128273261 15:66330857-66330879 ACAAATGAAACTGATAGGTCAGG + Intronic
1128725968 15:69988858-69988880 AAAAATGAGACTGATGTTTCTGG + Intergenic
1128825720 15:70714373-70714395 AGAGAAGAGAGTCAGGGGTCAGG - Intronic
1128893763 15:71354313-71354335 ATAAAGGAGACTGAGGGGAGAGG + Intronic
1129226128 15:74171471-74171493 AGAAATGAGACTGTGCGTGCTGG - Intergenic
1129519917 15:76179055-76179077 GGAAATGAGACTGTGGGCCCTGG + Intronic
1131669045 15:94599958-94599980 ATAAAGGAGATTGAGAGGTCAGG - Intergenic
1132006918 15:98235630-98235652 AGAAGAGAGAGGGAGGGGTCTGG - Intergenic
1133201287 16:4206257-4206279 AGAACCAGGACTGAGGGGTCAGG - Intronic
1133668678 16:7996110-7996132 TTAAATGAGACTGAGGGTGCTGG + Intergenic
1134211386 16:12280221-12280243 TGAAAGGAGACTCACGGGTCGGG + Intronic
1134620375 16:15684295-15684317 AGAAATGCCACTGAAGGGCCAGG + Intronic
1135083014 16:19452419-19452441 AGAAATGAGACTGGATGGCCGGG + Intronic
1137532374 16:49287487-49287509 AGAAATGGGGCTGAGAGGGCGGG + Intergenic
1137620654 16:49874410-49874432 CTTAAGGAGACTGAGGGGTCGGG + Intergenic
1138266071 16:55660547-55660569 AGAGATGAGAGTGAGTGGTCAGG + Intronic
1138679417 16:58674262-58674284 AGAAATGAGTGTTAGGGGACAGG - Intronic
1138946005 16:61850718-61850740 AGAAATGAAAATGTGGGGTAAGG - Intronic
1139669955 16:68485823-68485845 CCAAATGAGGCTGAGGGGACAGG - Intergenic
1140818649 16:78643338-78643360 AGTAATGAAACTGAGGCTTCTGG + Intronic
1141279386 16:82617228-82617250 GGAAATAAGACTGAGGAGTTTGG + Intergenic
1143202405 17:5122043-5122065 AGAAATGGATCAGAGGGGTCAGG + Intronic
1143648540 17:8248219-8248241 AGAAAAGAGACAGGGGTGTCGGG - Intronic
1144626967 17:16848887-16848909 AGAAATGGATCAGAGGGGTCAGG - Intergenic
1144879472 17:18423825-18423847 AGAAATGGATCAGAGGGGTCAGG + Intergenic
1145152768 17:20520562-20520584 AGAAATGGATCAGAGGGGTCAGG - Intergenic
1145243044 17:21250866-21250888 AACACTGAGGCTGAGGGGTCAGG - Intronic
1146164105 17:30574733-30574755 AGAAATGGATCAGAGGGGTCAGG - Intergenic
1146202469 17:30871643-30871665 AGAAATGACACAGATGGGCCAGG - Intronic
1146397698 17:32481776-32481798 GGAAATGAGACTGTGGGGTGTGG + Exonic
1147242764 17:39101446-39101468 AGAAAGGAGACAGAGGGCACGGG + Intronic
1147581103 17:41627572-41627594 AGAAATGGATCAGAGGGGTCAGG - Intergenic
1147847307 17:43413609-43413631 AGAAATCAGAATGATGGGGCCGG + Intergenic
1148450950 17:47777599-47777621 GGAAAGGAGGGTGAGGGGTCAGG - Intergenic
1148582998 17:48756410-48756432 TGAAAGGAGACTGTGGGGCCAGG + Intergenic
1149116441 17:53102743-53102765 ACAAATGACAATGAGGGGTGAGG - Intergenic
1150428766 17:65099242-65099264 AGAAATGAGACTCTGAAGTCTGG - Intergenic
1150509632 17:65736776-65736798 AGAAATGAGGCTGAGGATGCAGG + Intronic
1150811755 17:68362316-68362338 AGAAAGGAGAAAGAGGGGTTGGG - Intronic
1151156930 17:72131375-72131397 AGAAAGAAGGCTGAGGGGTGGGG - Intergenic
1151504466 17:74517605-74517627 AGACATGATGCTGAGGGGACAGG + Intergenic
1153623698 18:7003911-7003933 AGAGATGAGTTTGAGAGGTCAGG - Intronic
1153863477 18:9238030-9238052 TGAAATACCACTGAGGGGTCTGG - Intronic
1155337790 18:24783186-24783208 AGGAGGGAGACTGGGGGGTCTGG - Intergenic
1157825058 18:50805084-50805106 AGAAATATGACTGTGGGGCCGGG - Intronic
1158139723 18:54242848-54242870 AGAAATGAGACTGATGGCAATGG - Intergenic
1159479469 18:68969213-68969235 AGAAATGAGGATGAGGTGTCTGG - Intronic
1159851130 18:73528477-73528499 AGAAATAAGACTGAGAGGATGGG + Intergenic
1160144981 18:76356431-76356453 AGAAATCAGACAGAGGGATGTGG + Intergenic
1160258389 18:77266715-77266737 AAGAATGAGAGTGAAGGGTCGGG + Intronic
1160873420 19:1286869-1286891 TGAAAGGAGACTGAGGGGCCGGG + Intronic
1161900190 19:7112763-7112785 AGAAATGGGAGTGAGGGGAGGGG - Intronic
1162310567 19:9904612-9904634 AGAAGTGACTCTGAGGGGCCTGG + Intronic
1162597253 19:11639266-11639288 AAAAATAAGACTGAGAGATCAGG + Intergenic
1163299629 19:16435867-16435889 AGAGCTGGGACTGAGGGGCCTGG - Intronic
1163779483 19:19239129-19239151 AGAAATGAGAAGTAGGGGACAGG - Intronic
1164273913 19:23700241-23700263 AAAAATGAGGCTGAGACGTCGGG + Intergenic
1164941531 19:32255089-32255111 AGGAATGAGACTTAGGGGTGTGG - Intergenic
1165044277 19:33092339-33092361 AGAAAAGAGACTGCCGGGTGCGG - Intronic
1166754347 19:45181130-45181152 AGAAATCAGGCTGAGAGGGCGGG - Exonic
1167430456 19:49451322-49451344 AGAAATGGGAGTGGGGGGCCGGG - Intronic
1167593337 19:50415856-50415878 AGAAGTGAGAGCGAGGGGGCTGG - Intronic
1167686405 19:50959616-50959638 AGAATGGAGACTGAGAGGTGTGG + Intronic
1168221314 19:54962564-54962586 AGAAAAGAAAATGAGGGGCCGGG - Intronic
1168319574 19:55500900-55500922 AGAACTGGGTATGAGGGGTCGGG + Intronic
925818693 2:7778116-7778138 AGAAGTGAGAGGGAGGGGCCGGG + Intergenic
926409609 2:12589329-12589351 AGACATGATACTGAGGAGACAGG + Intergenic
926967068 2:18426476-18426498 AGAAAGGAGACTTCGGGGGCTGG + Intergenic
927838762 2:26423258-26423280 AGAAATGAGAAAGAGCTGTCAGG - Intronic
927922963 2:26987769-26987791 AGAAATGAGTCTGGGTGGTTAGG - Intronic
927923035 2:26988512-26988534 AGAAAGGAGACTGAAGTTTCTGG + Intronic
928134982 2:28681383-28681405 GGAAATGAGACTGAAGTGTGTGG + Intergenic
928615242 2:33031752-33031774 GGAAATGAGATTGAGTGGGCAGG + Intronic
929039939 2:37734582-37734604 AGGAATGAAACTGAGGGTCCAGG - Intronic
929168139 2:38904342-38904364 AGAAATGAGGCTGGAGGGGCAGG + Intronic
929466639 2:42150660-42150682 ATAAAGGAGACTGAGGAATCGGG + Intergenic
929641353 2:43583112-43583134 AGGAATTAGACAGAGAGGTCTGG - Intronic
930667633 2:54115519-54115541 GCAAATGAGACTGCGGGGCCTGG - Exonic
931042577 2:58315698-58315720 AGAATTGGGACTGAGGGGACAGG - Intergenic
931314725 2:61118065-61118087 AAAAATGAGATTGGGGGATCTGG + Exonic
932219269 2:69987378-69987400 AGGAATGGGACTGAAGTGTCAGG - Intergenic
934784327 2:96993886-96993908 AGAAGTGAGACAGAGTTGTCTGG + Intronic
936386241 2:112032198-112032220 AGAAATGAGAATCAAGCGTCAGG + Intergenic
937184457 2:120027167-120027189 AGAAATGTAACTGTTGGGTCAGG - Intronic
939666096 2:144953235-144953257 GGAAATGACACTGAGGGATGGGG + Intergenic
940087164 2:149873254-149873276 AAAAATGAGCCTTAGGGCTCTGG + Intergenic
940193739 2:151069924-151069946 AGAAAAGAGAAGGAGGGGTCAGG + Intergenic
941107626 2:161376160-161376182 AGAACACAGACTTAGGGGTCAGG + Intronic
941286000 2:163612802-163612824 AGAAAGGAAACTGAGGGGAAAGG + Intronic
941389676 2:164896105-164896127 AGAAAATAGATTGAGGGGTGGGG + Intergenic
941394969 2:164962997-164963019 AATAATAAGACAGAGGGGTCTGG + Intergenic
944465333 2:199994763-199994785 AGAAATGGGACTAAGGGAGCTGG + Intronic
946088010 2:217194168-217194190 AGAAATGAGCATGAGAGATCGGG + Intergenic
947066066 2:226226930-226226952 AGAAATGTCACTGAGGTGGCAGG - Intergenic
947391370 2:229642926-229642948 AAAAATAATACTAAGGGGTCAGG + Intronic
947643820 2:231723020-231723042 AGAGAAGGGACTGAGGGGACTGG + Intergenic
947882238 2:233527511-233527533 AGAAATGATACTGAGGGCCCAGG + Exonic
948145330 2:235704060-235704082 GGAAATGGGTGTGAGGGGTCAGG - Intronic
948685678 2:239668273-239668295 GGAAGGGAGACCGAGGGGTCTGG - Intergenic
1169368526 20:5010592-5010614 AGAAATGAGACTTTTGGGTTGGG + Intergenic
1169418931 20:5443472-5443494 AGAAATAAGACTCTGGGCTCTGG + Intergenic
1169978037 20:11352876-11352898 TGAAATGAGGCTGGTGGGTCTGG + Intergenic
1170032848 20:11960270-11960292 GGAAATTAGACTCAGGGATCAGG - Intergenic
1171032722 20:21691717-21691739 GGAAATGAGAATCAGGGCTCTGG + Intergenic
1171322180 20:24256054-24256076 GGAAATGAGACTGGAGGGGCAGG + Intergenic
1172092929 20:32446487-32446509 AGGAGTGAGTCTGAGGGGCCAGG + Exonic
1172976874 20:38912788-38912810 AGAAATGTGATTTGGGGGTCAGG - Intronic
1173946642 20:46956545-46956567 AGAAAAGAGAGGGAAGGGTCTGG + Intronic
1174424254 20:50420834-50420856 AAAAATGAGGCTGGGGGGTTAGG + Intergenic
1174551619 20:51366550-51366572 AGAAAGGACACTGAGTGGACAGG + Intergenic
1174965405 20:55208471-55208493 AAACATGAGACTGGGGGGACAGG + Intergenic
1176954339 21:15083607-15083629 AGAAATGATGCTGAGGTTTCTGG - Intergenic
1177595458 21:23234822-23234844 TAAAATGAGACTGAGGGTTGAGG - Intergenic
1179565984 21:42249383-42249405 AGAACTTAAACTGAGTGGTCTGG - Intronic
1180885120 22:19237525-19237547 AGAAATTAAACTGCTGGGTCAGG - Intronic
1183100566 22:35581286-35581308 AGAGATGAGACTGAGGAAACGGG - Intergenic
1183156585 22:36080375-36080397 AGTAATGAGATTGCTGGGTCAGG + Intergenic
1183438793 22:37811007-37811029 GGAACTGAGACTAAGGGCTCTGG + Intronic
1183965057 22:41436586-41436608 AGAGCTGGGACTGAGGGGCCGGG + Exonic
1184707676 22:46225439-46225461 GAAAATGAGACTGAGGGGCTTGG + Intronic
1184823260 22:46928940-46928962 AGAAATTAGAATGTGGGGGCCGG + Intronic
1184831529 22:46991901-46991923 AGAGATGAGAGAGAGGGTTCAGG - Intronic
949702551 3:6775858-6775880 AGAAAAGTGACTGATGGGCCGGG - Intronic
951566108 3:24013939-24013961 AGAAACAAGACTAAGGGGTTTGG - Intergenic
952338903 3:32428697-32428719 AGAAAAGAGCCTGAGGTGTCTGG - Intronic
952937757 3:38413505-38413527 AGAGAAGAGACTGTGGGGTTTGG - Exonic
953345863 3:42174861-42174883 AGAAATAACACAGAGGGGGCCGG - Intronic
955275127 3:57539909-57539931 AGAAATAAGACAGTGGGGCCGGG - Intronic
955951328 3:64245396-64245418 AAAGATGAGACTGAGAGGTGAGG - Intronic
959343155 3:105157213-105157235 AATAAGGAGACTGAGGGGTGGGG - Intergenic
961204112 3:125067295-125067317 AACAATGAGACAGAGGGGACAGG + Intergenic
961521532 3:127469876-127469898 AGATACTGGACTGAGGGGTCGGG - Intergenic
961574778 3:127825234-127825256 AGAACTGAGACTGTGGTGTGTGG + Intergenic
961758388 3:129145791-129145813 AGAAAGGACACTGGGAGGTCCGG - Exonic
962310154 3:134320552-134320574 AGGAATCAGACTGGGGGGTGGGG - Intergenic
962829247 3:139125392-139125414 AGAAATGAGAGTGTGGGCTTTGG + Intronic
963944161 3:151126966-151126988 AGCAATGAGACTGAGGGCCAAGG - Intronic
964405050 3:156340159-156340181 GGAAAGGATACTGAGGGGTAGGG - Intronic
965559237 3:170045830-170045852 AGAAATGAAACCCAGGGATCTGG - Intronic
965965389 3:174482674-174482696 AGGAATAAGACAGAGGGGTTGGG - Intronic
967426608 3:189334584-189334606 TTAAATGAGACTGAGTGGTTTGG + Intergenic
968437459 4:601411-601433 AGAAAAGAGACTGGGGGCCCTGG - Intergenic
968720247 4:2197221-2197243 AGAAAACAGACTGAAGGGGCAGG + Intronic
969267031 4:6071340-6071362 AGACTTGAGACAGAGGGGCCTGG + Intronic
969315914 4:6381220-6381242 AGCAGGGAGCCTGAGGGGTCAGG + Intronic
969919688 4:10525794-10525816 AGGTCTGAGGCTGAGGGGTCAGG - Intronic
970887545 4:21003964-21003986 GGAAATGAGCCTGAGAGGTATGG + Intronic
971427608 4:26531421-26531443 AGAAATGAGACAAAAGGGCCAGG - Intergenic
972431044 4:38982520-38982542 AGAAATGAGTCTGAGAGATTGGG - Intronic
972431207 4:38983866-38983888 AGAAATGAGTCTGAGGGATTGGG - Intronic
973921253 4:55687676-55687698 AGAAATGAGACTCATGTGTGAGG - Intergenic
976083250 4:81379845-81379867 AGAAAGGAGACTGAGGGGCCTGG - Intergenic
977206812 4:94172302-94172324 AGAGATGAGAATGAGTGGGCAGG + Intergenic
978945497 4:114490975-114490997 AGACATGAGTTTGAGGGGCCAGG + Intergenic
979124011 4:116944009-116944031 AAAAATGAAACTCAGAGGTCTGG + Intergenic
979864442 4:125736304-125736326 AGAAATGAGACTGAAGCATTAGG + Intergenic
980212465 4:129807517-129807539 AGGGGTGAGACTGAGGGGTGAGG + Intergenic
981181397 4:141750058-141750080 AAACATGTGACTCAGGGGTCTGG - Intergenic
981631806 4:146827356-146827378 AGAAATGCTACTGTGGGGGCGGG - Intronic
982251478 4:153411669-153411691 AGAAATGAGAATGAGGCACCAGG - Intronic
983221961 4:165052471-165052493 AAAAATGAAACTGAGTGGCCAGG - Intergenic
984083515 4:175279995-175280017 ACAAGTGGAACTGAGGGGTCAGG + Intergenic
984194017 4:176636853-176636875 ATAAATGATTCTGAGGGTTCAGG + Intergenic
985046867 4:185949539-185949561 AGAGATTAGACTAAGGGGGCGGG + Intronic
985729875 5:1541149-1541171 AGGGATGAGGCAGAGGGGTCAGG - Intergenic
987183066 5:15386492-15386514 AGAGATGAGACAGAAGGGTGGGG - Intergenic
989273352 5:39557583-39557605 AGAAAAGAGCCAGAGTGGTCAGG - Intergenic
993387566 5:87278249-87278271 AGAAATAAGACAGATGGGCCGGG + Intronic
993648163 5:90484648-90484670 AGAAATGAGACTGAGCTGATGGG + Intronic
993763557 5:91827432-91827454 AGAAATGAGACTGAGGTATATGG - Intergenic
994004570 5:94822575-94822597 AGTAATGAGATTGCTGGGTCAGG + Intronic
995764420 5:115600627-115600649 TCAAATGTTACTGAGGGGTCAGG + Intronic
996197563 5:120628333-120628355 ATAAGTGAGACTGAGTGGGCTGG + Intronic
996225068 5:120982614-120982636 AAAAATAAGACAGAGGGATCTGG + Intergenic
996449131 5:123598661-123598683 AGAAATGAGACTGAGAAGGTAGG + Intronic
998416766 5:141951834-141951856 AGGAATGAGTATGAGGGGACAGG - Intronic
999823730 5:155254320-155254342 CGAAAGGAGGCTGAGGGGTGTGG - Intergenic
1001105755 5:168852804-168852826 ACAACTGAGACTGAGGGGCATGG - Intronic
1001835091 5:174824949-174824971 AGATATGAGAGGGAGGGGTGAGG - Intergenic
1002179665 5:177424555-177424577 AGAAATGAGGCTGAAGTCTCAGG - Intronic
1002717499 5:181237052-181237074 AGAAATGACAGTGACAGGTCAGG + Intronic
1002741664 5:181438886-181438908 TGAAATGGGAGTGAGGGGTGAGG - Intergenic
1007667253 6:43522225-43522247 AGAAATGTGACTGATGATTCTGG - Intronic
1008313603 6:50010041-50010063 AGAAAAGAGACTTTGGAGTCAGG + Intronic
1010519323 6:76813071-76813093 AGAAAGGAGACTGCGGATTCAGG - Intergenic
1011504362 6:88024875-88024897 AAAAATAATACTGAGAGGTCAGG - Intergenic
1011756074 6:90499323-90499345 AGAAATGGATCTGAGAGGTCTGG + Intergenic
1011988082 6:93475307-93475329 AGAAATGAGACTGAAAGGGTAGG + Intergenic
1012546922 6:100430639-100430661 ATAAATGACAGTGAAGGGTCTGG - Intronic
1012735743 6:102940682-102940704 AGAAATGAGACAGAGGAATTAGG - Intergenic
1012938037 6:105388472-105388494 AGAAAGGAGATTGGGGGGTGGGG + Intronic
1015594258 6:134851161-134851183 AGTAATGAGACTTAGTCGTCAGG - Intergenic
1016497924 6:144685036-144685058 ACATATGAGACTCAGAGGTCGGG - Intronic
1017360977 6:153570908-153570930 AGAAAGGAGACTAAGGAGACAGG - Intergenic
1017589334 6:155961577-155961599 AGAAATGTGGGTGAGGGGTGGGG + Intergenic
1018478932 6:164170736-164170758 AGAAAGGAGGCTGAGGCGTACGG + Intergenic
1019246804 6:170714650-170714672 TGAAATGGGAGTGAGGGGTGAGG - Intergenic
1019622097 7:1997634-1997656 AGCCATGACACTGAGGGCTCTGG + Intronic
1020019949 7:4859581-4859603 AGGAAGGAGAATGAGGGGTACGG - Exonic
1022807472 7:33837263-33837285 AGAAGTAAGACTGAGAGGACAGG + Intergenic
1022828959 7:34045515-34045537 AAGAATGAGAATGAGGGGGCAGG + Intronic
1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG + Intronic
1023535245 7:41202029-41202051 AGAGATGAGCCAGAGGGCTCAGG - Intergenic
1023749738 7:43360849-43360871 AAAAATGAGACTGAGAAGTAGGG - Intronic
1024617564 7:51128518-51128540 AGAAATGAGAGGGAGGGGCGGGG + Intronic
1025248992 7:57339216-57339238 AGAAAAGAGAGTCAGGGGGCAGG - Intergenic
1026838265 7:73652597-73652619 AGAAGTGATACTGGGGGGCCGGG - Intergenic
1027233960 7:76287021-76287043 AGGAAAGAGACTGAGGGCCCTGG + Exonic
1027722756 7:81766170-81766192 AGAAATGAGTGTGAGGTGCCGGG - Intronic
1028888289 7:95958984-95959006 CTAAATCAAACTGAGGGGTCAGG + Intronic
1029425606 7:100492299-100492321 AGGAATGAGAGTGAGGGGGTTGG + Intronic
1030107735 7:106000681-106000703 AGTAATGAGACTGATAGGTTGGG - Intronic
1031385734 7:121148686-121148708 AGAAATGAGATTGAGTGAACTGG + Intronic
1032278909 7:130485668-130485690 TGGAATGAGACCAAGGGGTCGGG - Intergenic
1032670035 7:134074182-134074204 AGGAAAGAGACTCTGGGGTCAGG - Intergenic
1033631775 7:143165634-143165656 AGAAAGGCTACTCAGGGGTCAGG + Intergenic
1034831329 7:154310599-154310621 AGTATTGAGAATGAGGGGGCTGG - Intronic
1035501338 8:93310-93332 TGAAATGGGAGTGAGGGGTGAGG + Intergenic
1035834171 8:2730628-2730650 AGAAATTTGACTAAGAGGTCAGG + Intergenic
1036950786 8:13137196-13137218 AGGAAGGACACTGAGGGGCCTGG - Intronic
1038005434 8:23425931-23425953 AGAACTGAGACTCAGAGGCCTGG + Intronic
1038300092 8:26336465-26336487 AGATTTGAGACTGAGGGGTGGGG - Intronic
1039083798 8:33759909-33759931 GGACATGAGTTTGAGGGGTCAGG - Intergenic
1040982890 8:53263642-53263664 AAAAAAGAGACAGAGGGCTCTGG + Intergenic
1041873670 8:62663396-62663418 CGAAATGAAAATGAGAGGTCAGG + Intronic
1042121924 8:65497895-65497917 GGAAATGTGACTGAGGTGTTTGG - Intergenic
1042162142 8:65907252-65907274 AGAAATGAGACTGACTGGTAGGG - Intergenic
1042629805 8:70804312-70804334 AGAAGTAAGACTGCTGGGTCAGG + Intergenic
1043019913 8:74987298-74987320 AGAATTGAGACTCAGGAGTGAGG + Intronic
1043227700 8:77752627-77752649 AGTAATGGGACTGCTGGGTCTGG - Intergenic
1044391898 8:91661637-91661659 AGAAATGAGAATGTGTGGTAGGG - Intergenic
1045894783 8:107202170-107202192 GGAAATGAGATTGGGGGGGCAGG - Intergenic
1047183241 8:122609167-122609189 AAAAATGATTCTCAGGGGTCTGG + Intergenic
1048372024 8:133786938-133786960 GGAAATGAGACTGAAGGGGTGGG + Intergenic
1048670309 8:136712022-136712044 GGAGATAAGCCTGAGGGGTCGGG + Intergenic
1049317820 8:141978738-141978760 AGAAATGGGACTGGAGGGTGAGG - Intergenic
1050509018 9:6374898-6374920 AGATAGGATACTCAGGGGTCAGG - Intergenic
1051506449 9:17832231-17832253 AGACAAGAGACTGAAAGGTCAGG + Intergenic
1051528135 9:18070462-18070484 AGAAATGAGAGAGAGAGGTAGGG + Intergenic
1054817220 9:69486737-69486759 AGAAATGAGGCTGCGGAGCCGGG + Intronic
1054922894 9:70559703-70559725 AGAAATGGGAATGTGAGGTCTGG + Intronic
1055934837 9:81595161-81595183 AAAAATGAGATTGAGTGGTTTGG - Intronic
1056201946 9:84285620-84285642 CTAAAGGAGACAGAGGGGTCAGG - Intronic
1056830234 9:89911002-89911024 AGCAGTGAGACTAATGGGTCAGG + Intergenic
1056883602 9:90418988-90419010 AGAGATGACACAGAGGGTTCTGG + Intergenic
1057010753 9:91599185-91599207 AAAAATGAGAATGAGTGGGCCGG + Intronic
1059264153 9:113010349-113010371 AGAAGTGAGACTGAGGAAACAGG - Intergenic
1059708814 9:116848580-116848602 AGAAAAGAGACTCAGGTGCCAGG - Intronic
1060583086 9:124770133-124770155 AGAACTGAGACTAAGAGGTGGGG + Intronic
1060971259 9:127739536-127739558 AGACATGAGAGGAAGGGGTCAGG + Intronic
1061100568 9:128488714-128488736 TGAAATGAGAATAAGGGGCCGGG + Intronic
1062322526 9:135997361-135997383 AGAGAGGAGCCTGAGGGGGCGGG - Intergenic
1186697683 X:12054493-12054515 GGTAATGAGAATGGGGGGTCAGG - Intergenic
1186822722 X:13307540-13307562 TGAAATGATACTGAGGGGAGGGG - Intergenic
1187261203 X:17686732-17686754 AGAGATGAGACTGGGAGGTGGGG + Intronic
1188021468 X:25163284-25163306 AGAAATGAGGCAGAGGAGCCAGG - Intergenic
1189254897 X:39630192-39630214 AGGAAGGAGAATGAGGGGGCTGG - Intergenic
1190573524 X:51809411-51809433 AAAAAGGAGACTAAGGGGCCGGG - Intronic
1191072862 X:56420855-56420877 AGAACTGAGGCTGAGGGTCCTGG - Intergenic
1191693900 X:63968445-63968467 TGAAATGAGACTGAGCCATCAGG + Intergenic
1194174579 X:90630218-90630240 AAAAATCAGACTGTTGGGTCAGG + Intergenic
1195111872 X:101657731-101657753 AAAAATGAGGCTTAGGGCTCTGG + Intronic
1197180410 X:123529532-123529554 AGTAATGAGATTGCTGGGTCAGG + Intergenic
1197786344 X:130200940-130200962 ATAAATGAGACTGAGAGGCTGGG + Intergenic
1198666111 X:139025108-139025130 TGAAAAGACACTGAGGGGACTGG - Intronic
1199766520 X:150945546-150945568 AGAAAGGAGACTGAGGGGCAAGG - Intergenic
1201117395 Y:10845152-10845174 AGAAATGGAACTGAGGGGAATGG - Intergenic
1201412946 Y:13719428-13719450 AAAAATGAGAAGGAGAGGTCAGG + Intergenic