ID: 1113706105

View in Genome Browser
Species Human (GRCh38)
Location 13:112433930-112433952
Sequence CTGGGACCTGACTGTTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113706099_1113706105 -2 Left 1113706099 13:112433909-112433931 CCTTGTCAAGATTCCAGTTCCCT 0: 2
1: 0
2: 1
3: 21
4: 196
Right 1113706105 13:112433930-112433952 CTGGGACCTGACTGTTCTGCAGG 0: 1
1: 1
2: 0
3: 16
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113706105 Original CRISPR CTGGGACCTGACTGTTCTGC AGG Intronic
900351029 1:2234633-2234655 CTGGGCCCTGACTGTCTGGCAGG + Intronic
901430524 1:9211333-9211355 CTGGGACCACACTCTTCCGCTGG + Intergenic
902220260 1:14960038-14960060 TTTGCACCTGACTGTCCTGCAGG - Intronic
903511013 1:23874921-23874943 CTGGCACCTGCCTGTCCTGGTGG + Exonic
903516506 1:23914557-23914579 GTGGCACATGCCTGTTCTGCCGG - Intergenic
903967062 1:27097478-27097500 CTGGGACCTGAGTGTGGAGCTGG - Intergenic
905920332 1:41714989-41715011 CTGGCATCTCACTGGTCTGCTGG + Intronic
907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG + Intronic
907556542 1:55349127-55349149 GTGGGGCCTGACTCTTCTGTTGG - Intergenic
910105463 1:83627173-83627195 CTGTGACCTGACTGTCCATCTGG - Intergenic
911244209 1:95498870-95498892 CTTGGACCTGCCTCTTCAGCAGG + Intergenic
912609687 1:111030310-111030332 CTGGGACCCGTCAGTCCTGCTGG - Intergenic
917061622 1:171048230-171048252 GGGGGACCTCACTGTTCTGAAGG - Intronic
917479902 1:175403139-175403161 CAGGGCCCTGACTGCTCAGCAGG - Exonic
917498827 1:175567320-175567342 CTGAGAGCTGACAGTGCTGCGGG + Intronic
918566979 1:185945797-185945819 TTTGGATCTCACTGTTCTGCTGG - Intronic
918799410 1:188953433-188953455 CTGGGACATGTCTGTCCTGCAGG + Intergenic
920681096 1:208073361-208073383 CTGGAAACTGACTGCCCTGCAGG - Intronic
1063932869 10:11046673-11046695 ATGGGTCCTGAGGGTTCTGCGGG - Intronic
1065624119 10:27613367-27613389 CTAGGCCCTGAGTGTCCTGCAGG + Intergenic
1067848519 10:49740672-49740694 CTGGGGCCTGCCTGGCCTGCAGG + Intronic
1069637229 10:69932452-69932474 CTGGGACGTGACTGGTCTAGGGG - Intronic
1069686320 10:70321392-70321414 CTGTGACCTGGCTCTCCTGCTGG + Intronic
1070337829 10:75470742-75470764 CTGGGACGTGACTGTTCCAACGG - Intronic
1070850856 10:79560537-79560559 CTGCAGCCTGAGTGTTCTGCAGG - Intergenic
1074574587 10:114656331-114656353 CTGGGACCTTAATATGCTGCTGG + Intronic
1074823269 10:117197383-117197405 CTGGAGCCTGGCTGTTCTCCGGG + Intergenic
1075467557 10:122662990-122663012 CTGGGACCTCAAGGTTATGCAGG + Intergenic
1075733747 10:124651688-124651710 CTGGGGCCTGCCTGCTCTGGAGG + Intronic
1076526534 10:131115856-131115878 CTCAGACCTCTCTGTTCTGCAGG + Intronic
1077049392 11:560056-560078 CTGGGACCTGGCTTTTCTCCTGG - Intronic
1080187950 11:29513273-29513295 CTGGGGCCTGTCTGTTCTTGGGG - Intergenic
1080955011 11:37083231-37083253 CTGGGACATCTCTGATCTGCAGG - Intergenic
1083376233 11:62224208-62224230 CTGGGGCCAGACAGTACTGCTGG - Intergenic
1083718594 11:64592890-64592912 CTGGGACCTGCCTGGACTGGGGG - Intronic
1084118310 11:67054631-67054653 CTGGGACCATACTGTTTTCCTGG - Intergenic
1084345376 11:68543723-68543745 CTGGGTCCTGGCTGTCCAGCAGG + Intronic
1085601785 11:77861949-77861971 CTGTCACCTGACTGTACTGAAGG - Intronic
1085634512 11:78148021-78148043 CTGGGACCTGGCTGGCCTGCTGG + Intergenic
1087170172 11:95041824-95041846 CTGGGCCCTGACTCATCTCCTGG + Intergenic
1087479456 11:98680833-98680855 CTGGGGCATGTCTGTTCTGTAGG - Intergenic
1089542116 11:119195606-119195628 CTGTGAACTGACTTTTCTGAAGG - Intronic
1089702481 11:120253917-120253939 CTGGGACCTCCCTCTCCTGCTGG - Intronic
1089997710 11:122924728-122924750 CAGGGACCTGATTGTTCTTAAGG - Intronic
1090385644 11:126356217-126356239 TTGGGAGCTGACTGTGCTGGAGG + Intronic
1091298621 11:134490415-134490437 CTGGGACCTTCCTGCTTTGCAGG + Intergenic
1093482969 12:19624229-19624251 CTGGGTACTGACTGTGCTGCAGG - Intronic
1095049662 12:37544645-37544667 ATGGGAGCTCACTGTCCTGCAGG + Intergenic
1096588760 12:52643522-52643544 CTGGGTCCTGGCTGGTCTGGAGG + Intergenic
1097961138 12:65532897-65532919 CTGGGGGCTAACTGGTCTGCTGG + Intergenic
1099373415 12:81866116-81866138 CTGGGGCATGTCTGTCCTGCAGG - Intergenic
1101906519 12:108830721-108830743 CAGAGACCTGAATGTTCTTCTGG + Intronic
1102587200 12:113931718-113931740 CTGGCCTCTGCCTGTTCTGCTGG + Intronic
1102914647 12:116743788-116743810 ATGGTGCCTGCCTGTTCTGCAGG + Intronic
1103330139 12:120148526-120148548 CTGGGATCCCACTGTTCAGCAGG - Intronic
1103913752 12:124365528-124365550 ATGTGACCGGCCTGTTCTGCAGG + Intronic
1104624288 12:130338984-130339006 CGGGGACCTGAGAGCTCTGCAGG + Intronic
1105751465 13:23425392-23425414 CTGGGACCTGATGTTTATGCAGG + Intronic
1106435700 13:29721426-29721448 CAGGGTCCTGCCTGTTTTGCTGG + Intergenic
1108596462 13:51954224-51954246 CTGGGACCTGCCAGTGGTGCAGG + Intronic
1110039765 13:70738444-70738466 CTTGTCCCTGACTGTGCTGCTGG + Intergenic
1111794763 13:92904876-92904898 CTGTGACCTGAATATTCTGATGG - Intergenic
1112796835 13:103066297-103066319 CTGGGCCCTGGCTCTGCTGCTGG + Exonic
1113335785 13:109374470-109374492 CTGGGACCTGCCTGAGCTGAAGG - Intergenic
1113521790 13:110946773-110946795 CTGGGACTTGACTGTTCTGCAGG - Intergenic
1113706105 13:112433930-112433952 CTGGGACCTGACTGTTCTGCAGG + Intronic
1115773139 14:36687276-36687298 GTGGGATCTTACTGTTGTGCTGG - Intronic
1116073099 14:40074218-40074240 CAGGGTCATGGCTGTTCTGCTGG - Intergenic
1116186257 14:41604980-41605002 CTGGGATCTGCCTGTACTCCAGG + Intergenic
1117387571 14:55231392-55231414 CTGGGAACTGAGCTTTCTGCAGG + Intergenic
1117527757 14:56627838-56627860 CTGTGTCCTGACTGTTGTGGTGG - Intronic
1120525080 14:85568194-85568216 ATGGGACCTTGCTGATCTGCGGG + Intronic
1121300057 14:92862915-92862937 CTGGGCTCTGACTGTCCTGGGGG + Intergenic
1122296633 14:100709593-100709615 CTCGGAGCCGACTGTTCTCCCGG - Intergenic
1122354548 14:101115020-101115042 CTGGACCCTGACTATTCAGCAGG - Intergenic
1202896390 14_GL000194v1_random:13044-13066 CTGGGGCCTGACTGTCCACCCGG + Intergenic
1123939211 15:25208678-25208700 CTGGGAGCTGCCTGCCCTGCAGG - Intergenic
1123946369 15:25240758-25240780 CTGGTACCTGATGGTGCTGCAGG + Intergenic
1125271569 15:37944488-37944510 CTGAGAACTGACTGTTTGGCAGG + Intronic
1125956985 15:43797307-43797329 CTGGTTCCTGGCTGTCCTGCTGG - Exonic
1126489983 15:49225990-49226012 ATGGGGCATGTCTGTTCTGCAGG - Intronic
1127999490 15:64177438-64177460 CTGGGCCCTGACAGTTCTCTGGG + Intronic
1130309649 15:82742079-82742101 CTGTGACCTCACTTTTCTTCTGG - Intergenic
1131957829 15:97756733-97756755 CTGGGAGCTGAGGGTCCTGCTGG - Intergenic
1132325455 15:100965060-100965082 CAGGCAGCTCACTGTTCTGCAGG - Intronic
1132500385 16:282295-282317 AGGGGACCTGGCTGTTCTGAAGG + Exonic
1133267073 16:4591753-4591775 CTGGATCCTGACAGTGCTGCTGG + Exonic
1133828742 16:9302356-9302378 CCGGGACAGCACTGTTCTGCAGG + Intergenic
1134116630 16:11553550-11553572 CTCTGACCTGGCTGTCCTGCGGG - Exonic
1136403789 16:30031730-30031752 GGGGCACCTGACTGTGCTGCAGG + Intronic
1136935981 16:34465156-34465178 CTGGAACCTAACTGTCCTCCTGG - Intergenic
1136963840 16:34883414-34883436 CTGGAACCTAACTGTCCTCCTGG + Intergenic
1137092983 16:36217891-36217913 CTGGGACCTAACTCTCCTCCTGG + Intergenic
1137235330 16:46612124-46612146 CTGGGACACCACTGTTCAGCTGG - Intronic
1138490300 16:57372613-57372635 CTGCCATCTGACTGTCCTGCTGG + Exonic
1141257992 16:82421469-82421491 CTGGGTCCTGACTCTACTCCTGG - Intergenic
1141599178 16:85114853-85114875 CCAGGACCTGGCTGTTCAGCTGG - Intergenic
1141703710 16:85653641-85653663 CTGGGCCCTGACTGGCCAGCTGG - Intronic
1143108325 17:4540454-4540476 CTTGGACCTGACGGTGCTCCTGG - Exonic
1145241743 17:21244147-21244169 CTGGGACCTCGGTGTGCTGCAGG + Exonic
1145988417 17:29062921-29062943 CTGGGAGCTGCCTGATCAGCTGG + Intergenic
1149194422 17:54102486-54102508 CTGGGGCATGTCTGCTCTGCAGG + Intergenic
1149867608 17:60159361-60159383 CTGGGCCCTGCCTGCCCTGCTGG + Exonic
1151543341 17:74776556-74776578 TTGGGAGCTGGCTGTGCTGCAGG + Exonic
1152043818 17:77922978-77923000 CTGGGAGCTGACTGTACAACTGG + Intergenic
1152206180 17:78975907-78975929 CTGGGAGCTGGCTGTGCTGTGGG + Intronic
1152495588 17:80669101-80669123 GTGGGACCTGCCCGTTCTGCTGG + Intronic
1152562584 17:81085984-81086006 CTGGTGCCTGACTCTGCTGCCGG + Intronic
1157053569 18:44198448-44198470 CTGGGGCATGTCTGTCCTGCAGG + Intergenic
1157283996 18:46364792-46364814 AGTGGACCTGACTCTTCTGCAGG - Intronic
1158837249 18:61343920-61343942 CTGGGAACTCACTGCTCTCCAGG - Intronic
1160557178 18:79733529-79733551 CTCGTTCCTGCCTGTTCTGCTGG + Intronic
1161296523 19:3523155-3523177 CTGGGACCTGAGTGGTCCGTGGG - Intronic
1162420076 19:10561139-10561161 CTGGGGCCTGACTGGACTGCTGG - Intronic
1162596128 19:11630608-11630630 CTGGGCCCTGAGTGATCAGCAGG + Intergenic
1163633260 19:18427531-18427553 CTGGGAACTGAGGGCTCTGCAGG + Intronic
1165049906 19:33134705-33134727 CTGGGACCGGGCTTTTCTCCGGG - Intronic
1165455773 19:35909639-35909661 CTGGGACCTGACCCTCCTCCAGG - Intergenic
1167423192 19:49415630-49415652 CTGGGAGCTGAGTGTCCTGGAGG - Intronic
1167778248 19:51576673-51576695 ATTGGACCTGGCTGTTCTCCTGG + Intronic
925014877 2:515161-515183 CTGTGACCTCAATTTTCTGCTGG + Intergenic
925042013 2:739815-739837 ATGGGAGCTGACTGTCCTGGGGG + Intergenic
925050004 2:806044-806066 CTGGGAACTGGCTGTGCTGGTGG + Intergenic
925774623 2:7322558-7322580 CTGGGCCCTGGCTGCTCTGCAGG + Intergenic
925823367 2:7822578-7822600 CAGGGACCTGACTGCCCTCCAGG + Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
926496551 2:13595308-13595330 CTGTGACCTGAATTTTCTGTTGG + Intergenic
926699054 2:15790565-15790587 CCCGGACGTGCCTGTTCTGCAGG + Intergenic
927711261 2:25327867-25327889 GTGGGACCTGAGTTTTCTCCAGG - Intronic
927881718 2:26693797-26693819 CTGTGAGGTGACTGTTTTGCTGG - Intronic
928239681 2:29575732-29575754 CTGGGAACTCACTTATCTGCCGG - Intronic
928408397 2:31032922-31032944 CTGGGAGCTGACTGTTCCAGTGG - Intronic
928917185 2:36484671-36484693 CTGTGATCTGAGTGTTCTTCAGG + Intronic
932197343 2:69796078-69796100 CTAGGACCTGTCAGTCCTGCCGG + Intronic
932396932 2:71454845-71454867 CTGGGCCCTGGCTGCTCTCCAGG + Intronic
932485958 2:72084420-72084442 CTGAGACCTGACTTTCCTCCAGG - Intergenic
932844430 2:75120674-75120696 CTGGGTCCTGGCTCTCCTGCTGG - Exonic
935594162 2:104866909-104866931 CTGGGACCTGGCTGCCCTGTGGG + Intergenic
938986668 2:136583210-136583232 CTGGGACCAGCCTGTCCTGGAGG - Intergenic
939094221 2:137815046-137815068 CTGGGACATGGCTCTTCTGCTGG - Intergenic
940152053 2:150613446-150613468 CTGGGACCTAACAGCCCTGCAGG + Intergenic
943162766 2:184276669-184276691 CTTAGAGCTGACTGTTCTACTGG - Intergenic
944037407 2:195311717-195311739 CTGGAACATAACTGGTCTGCTGG + Intergenic
944674030 2:202020242-202020264 GAGGGACCTGGCTGTGCTGCTGG - Intergenic
947828708 2:233124284-233124306 CTGGCTCCTGCCTGTTCTGGGGG + Intronic
1168964052 20:1888231-1888253 CTGGGACCGGAGTGTGATGCAGG + Intergenic
1169878274 20:10321141-10321163 CTGGTATTTGAATGTTCTGCTGG - Intergenic
1171063893 20:21994444-21994466 CTGAGACCTGACTGTGTTCCAGG - Intergenic
1172121580 20:32602018-32602040 CTGGGGACTGACTGGCCTGCAGG + Intronic
1173551157 20:43933989-43934011 CTGGGAGCTGCGTGTGCTGCAGG + Intronic
1175418896 20:58819019-58819041 CTGGGAACTGGCTGCTCTGCAGG - Intergenic
1175493711 20:59397386-59397408 CTCTGACCTGCCTGGTCTGCAGG + Intergenic
1176616078 21:9029040-9029062 CTGGGGCCTGACTGTCCACCTGG + Intergenic
1176709080 21:10134697-10134719 CTGGGGCCTGACTGTCCACCTGG - Intergenic
1181135742 22:20764988-20765010 CTGGGACCTGTTTGTCCTGGGGG - Intronic
1183491936 22:38121522-38121544 CTTGGCCCTGTCTGTTCTGAAGG - Intronic
950748825 3:15112669-15112691 CTGGGATCTGAGTGCTCTGCTGG - Intergenic
953884872 3:46709509-46709531 CTGGGGTCTGACTGTCCTGAGGG - Intronic
954379212 3:50210774-50210796 CTGGGACCTGTTTGTTTTCCTGG - Intronic
955300347 3:57772260-57772282 CTGCCTCCTGACTGTTCTTCTGG - Intronic
955301698 3:57786295-57786317 CTGGGACATGTATGTTCTGGTGG + Intronic
955337510 3:58098977-58098999 TTGGGCCCTGACTGTTTTCCTGG - Intronic
956092948 3:65687472-65687494 CTGGGTCCTGATTGCTCTTCAGG - Intronic
959179308 3:102958229-102958251 CTGAGTCCTGACTGTCCTGAAGG - Intergenic
960595259 3:119402376-119402398 CTGGGAGCTGAGACTTCTGCAGG + Exonic
962745661 3:138395959-138395981 CTGGGAGCTAACAGTCCTGCTGG + Intronic
966466505 3:180235643-180235665 CTGGGACCTGCCTGTGCACCAGG + Intergenic
967369718 3:188730705-188730727 CTGTGATCTGACAGTTCTGTAGG + Intronic
967809225 3:193742662-193742684 CTGGGTTTTGACTGTTCAGCTGG + Intergenic
968114468 3:196079155-196079177 TTGGGTCCTTACTGTTCTGGTGG - Intronic
969631558 4:8341660-8341682 CTGGGAAGTGACTGTGCTCCTGG + Intergenic
978857646 4:113411559-113411581 CTGGGAACTGGCTGGGCTGCCGG + Intergenic
979136536 4:117117809-117117831 CTGGGACCCATCAGTTCTGCTGG + Intergenic
979206675 4:118046476-118046498 CTGGATCATGTCTGTTCTGCAGG + Intronic
981312925 4:143314280-143314302 CTGGGACCTGACTGTCTCCCTGG - Intergenic
982259954 4:153486562-153486584 TTCGGACCTGTCTGTTCTGTTGG + Intronic
983461043 4:168026527-168026549 CTGGGACCTGTCAGTCCTGTTGG + Intergenic
986190332 5:5491162-5491184 CTGGGAGCTGACGGTTGTGAGGG + Intergenic
990998639 5:61759229-61759251 CTGGGTCCTGATTGTGCTGGCGG - Intergenic
991556314 5:67898536-67898558 CTGGGGCCTGTCTGCTCTTCTGG - Intergenic
995417280 5:111925214-111925236 CTGGGACCCATCAGTTCTGCTGG + Intronic
997371485 5:133364018-133364040 CTGGGCCCTGAATGTGCTGCTGG + Intronic
999107685 5:149088020-149088042 TTGGGACCTGACTTATCTGCAGG - Intergenic
1001269836 5:170302832-170302854 AGGGGTCCTGACTGCTCTGCTGG + Intergenic
1004248371 6:14002200-14002222 ATGGGACCTCACTGTTCTCGGGG - Intergenic
1005939164 6:30547830-30547852 CTGGGTACTTACTGTACTGCAGG - Intronic
1006239494 6:32665081-32665103 CTGGGGCCTGACTGACCGGCCGG - Intronic
1007760104 6:44128251-44128273 CTGGGGACTGACTGGTCGGCGGG + Intronic
1008525062 6:52399355-52399377 CTGGCATCTGTCTGTTCTGAGGG - Intronic
1010125132 6:72422449-72422471 CTGGCACAGCACTGTTCTGCTGG - Intergenic
1010130668 6:72489680-72489702 CTGGGAACTGTCTGCTCTGAAGG - Intergenic
1013408961 6:109867365-109867387 CTCTGACCTGACTGTTCAGAAGG + Intergenic
1016857384 6:148684577-148684599 TTGGGAGCAGACTGCTCTGCTGG - Intergenic
1023257036 7:38322607-38322629 CAGGGACCTGGCCCTTCTGCTGG + Intergenic
1024141509 7:46467326-46467348 CTGGGACCCGTCAGTCCTGCTGG + Intergenic
1024902603 7:54337930-54337952 CTGAGACCTCACTTTTCTGTGGG + Intergenic
1025254309 7:57373105-57373127 CTGGGACCTGCCTTACCTGCAGG + Intergenic
1028588598 7:92474328-92474350 CTGTCACCTGACTCTTCTGAAGG - Intronic
1031515648 7:122694999-122695021 CAGGGATCTGACTTTTCTGATGG - Intronic
1032464410 7:132134819-132134841 CTGGGCCCTGAGGGTTCTGAAGG - Intronic
1032768474 7:135023728-135023750 CTGGGGCATGTCTGTTCTTCAGG + Intronic
1033352545 7:140573438-140573460 CTGGGACCTGCCTCTGCAGCGGG + Intronic
1035051645 7:156002203-156002225 TTGGAACCTGACGCTTCTGCCGG + Intergenic
1035221306 7:157408041-157408063 CTGCCACCTGTTTGTTCTGCAGG + Intronic
1039025856 8:33257066-33257088 CTGGGACCTGATTGTTCTCTAGG - Intergenic
1041971454 8:63747518-63747540 CTGGGTCCTGACTGAGCTGAGGG - Intergenic
1043485009 8:80690641-80690663 CAGTGACCTGACTGCTCTTCTGG - Intronic
1044186128 8:89254069-89254091 CTGGGGTATGACTGTTCTGCAGG - Intergenic
1047927273 8:129693798-129693820 CTGGGACCTGAATGATGAGCAGG - Intergenic
1050095696 9:2063228-2063250 CTGGTACCTGTCTCTTTTGCGGG + Intronic
1051340207 9:16103700-16103722 CTCGGATCTGTTTGTTCTGCAGG - Intergenic
1052650023 9:31290713-31290735 CTGGGGCATATCTGTTCTGCAGG + Intergenic
1053556141 9:39138872-39138894 CTGTGACCTCACTTCTCTGCTGG + Intronic
1053646051 9:40120216-40120238 CTGGGGCCTGACTGTCCACCTGG - Intergenic
1053759665 9:41343324-41343346 CTGGGGCCTGACTGTCCACCTGG + Intergenic
1053820259 9:41959122-41959144 CTGTGACCTCACTTCTCTGCTGG + Intronic
1054110535 9:61102811-61102833 CTGTGACCTCACTTCTCTGCTGG + Intergenic
1054327062 9:63718113-63718135 CTGGGGCCTGACTGTCCACCTGG - Intergenic
1054538519 9:66255760-66255782 CTGGGGCCTGACTGTCCACCTGG + Intergenic
1054610322 9:67228314-67228336 CTGTGACCTCACTTCTCTGCTGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056303708 9:85268750-85268772 CAGGGACCTGGCTGTTCTGGGGG + Intergenic
1056764632 9:89437165-89437187 CAGGGCCCTGGCTGCTCTGCGGG + Intronic
1056913855 9:90728318-90728340 CTGGGACCTGGCTGGGCGGCTGG - Intergenic
1057091423 9:92261497-92261519 CAGTAACCTGACTGTGCTGCTGG + Intronic
1057094636 9:92294628-92294650 TTGGTACCTTACTGATCTGCTGG + Intergenic
1202793840 9_KI270719v1_random:103667-103689 CTGGGGCCTGACTGTCCACCTGG - Intergenic
1186247663 X:7631589-7631611 CTGGGGCATGTCTGTTATGCAGG + Intergenic
1188626080 X:32286403-32286425 CTCTGACCTGCCTGTTCTTCAGG - Intronic
1197290207 X:124646708-124646730 CTTGGACCTGACTGTGCTAGAGG - Exonic
1200210638 X:154345348-154345370 CTGGGTCCTGCCTGGGCTGCTGG - Intergenic
1200220214 X:154386744-154386766 CTGGGTCCTGCCTGGGCTGCTGG + Intergenic
1201349489 Y:13023875-13023897 CTGGGGCATGTCTGTCCTGCAGG - Intergenic
1201797164 Y:17908822-17908844 CTTGGAAATGCCTGTTCTGCTGG - Intergenic
1201804389 Y:17997163-17997185 CTTGGAAATGCCTGTTCTGCTGG + Intergenic
1202358534 Y:24077867-24077889 CTTGGAAATGCCTGTTCTGCTGG - Intergenic
1202512244 Y:25592246-25592268 CTTGGAAATGCCTGTTCTGCTGG + Intergenic