ID: 1113709457

View in Genome Browser
Species Human (GRCh38)
Location 13:112454102-112454124
Sequence GTTGCCCTTGGGAACCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113709457_1113709466 22 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709466 13:112454147-112454169 CTACCTGGAGCTTGGGCCCCTGG No data
1113709457_1113709465 15 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709465 13:112454140-112454162 GGCACGTCTACCTGGAGCTTGGG No data
1113709457_1113709461 -6 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709461 13:112454119-112454141 GGCAACCACACAGCTAAGCTGGG No data
1113709457_1113709464 14 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709464 13:112454139-112454161 GGGCACGTCTACCTGGAGCTTGG No data
1113709457_1113709468 29 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data
1113709457_1113709460 -7 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709460 13:112454118-112454140 GGGCAACCACACAGCTAAGCTGG No data
1113709457_1113709469 30 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709469 13:112454155-112454177 AGCTTGGGCCCCTGGAGTGAGGG No data
1113709457_1113709463 7 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709463 13:112454132-112454154 CTAAGCTGGGCACGTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113709457 Original CRISPR GTTGCCCTTGGGAACCACAG TGG (reversed) Intergenic