ID: 1113709458

View in Genome Browser
Species Human (GRCh38)
Location 13:112454113-112454135
Sequence TTAGCTGTGTGGTTGCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113709458_1113709464 3 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709464 13:112454139-112454161 GGGCACGTCTACCTGGAGCTTGG No data
1113709458_1113709465 4 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709465 13:112454140-112454162 GGCACGTCTACCTGGAGCTTGGG No data
1113709458_1113709470 25 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709470 13:112454161-112454183 GGCCCCTGGAGTGAGGGTTCAGG No data
1113709458_1113709469 19 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709469 13:112454155-112454177 AGCTTGGGCCCCTGGAGTGAGGG No data
1113709458_1113709466 11 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709466 13:112454147-112454169 CTACCTGGAGCTTGGGCCCCTGG No data
1113709458_1113709468 18 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data
1113709458_1113709463 -4 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709463 13:112454132-112454154 CTAAGCTGGGCACGTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113709458 Original CRISPR TTAGCTGTGTGGTTGCCCTT GGG (reversed) Intergenic