ID: 1113709459

View in Genome Browser
Species Human (GRCh38)
Location 13:112454114-112454136
Sequence CTTAGCTGTGTGGTTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113709459_1113709465 3 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709465 13:112454140-112454162 GGCACGTCTACCTGGAGCTTGGG No data
1113709459_1113709463 -5 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709463 13:112454132-112454154 CTAAGCTGGGCACGTCTACCTGG No data
1113709459_1113709470 24 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709470 13:112454161-112454183 GGCCCCTGGAGTGAGGGTTCAGG No data
1113709459_1113709466 10 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709466 13:112454147-112454169 CTACCTGGAGCTTGGGCCCCTGG No data
1113709459_1113709464 2 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709464 13:112454139-112454161 GGGCACGTCTACCTGGAGCTTGG No data
1113709459_1113709469 18 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709469 13:112454155-112454177 AGCTTGGGCCCCTGGAGTGAGGG No data
1113709459_1113709468 17 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113709459 Original CRISPR CTTAGCTGTGTGGTTGCCCT TGG (reversed) Intergenic