ID: 1113709462

View in Genome Browser
Species Human (GRCh38)
Location 13:112454124-112454146
Sequence ACGTGCCCAGCTTAGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113709462_1113709470 14 Left 1113709462 13:112454124-112454146 CCACACAGCTAAGCTGGGCACGT No data
Right 1113709470 13:112454161-112454183 GGCCCCTGGAGTGAGGGTTCAGG No data
1113709462_1113709465 -7 Left 1113709462 13:112454124-112454146 CCACACAGCTAAGCTGGGCACGT No data
Right 1113709465 13:112454140-112454162 GGCACGTCTACCTGGAGCTTGGG No data
1113709462_1113709468 7 Left 1113709462 13:112454124-112454146 CCACACAGCTAAGCTGGGCACGT No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data
1113709462_1113709466 0 Left 1113709462 13:112454124-112454146 CCACACAGCTAAGCTGGGCACGT No data
Right 1113709466 13:112454147-112454169 CTACCTGGAGCTTGGGCCCCTGG No data
1113709462_1113709469 8 Left 1113709462 13:112454124-112454146 CCACACAGCTAAGCTGGGCACGT No data
Right 1113709469 13:112454155-112454177 AGCTTGGGCCCCTGGAGTGAGGG No data
1113709462_1113709464 -8 Left 1113709462 13:112454124-112454146 CCACACAGCTAAGCTGGGCACGT No data
Right 1113709464 13:112454139-112454161 GGGCACGTCTACCTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113709462 Original CRISPR ACGTGCCCAGCTTAGCTGTG TGG (reversed) Intergenic