ID: 1113709468

View in Genome Browser
Species Human (GRCh38)
Location 13:112454154-112454176
Sequence GAGCTTGGGCCCCTGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113709462_1113709468 7 Left 1113709462 13:112454124-112454146 CCACACAGCTAAGCTGGGCACGT No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data
1113709457_1113709468 29 Left 1113709457 13:112454102-112454124 CCACTGTGGTTCCCAAGGGCAAC No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data
1113709458_1113709468 18 Left 1113709458 13:112454113-112454135 CCCAAGGGCAACCACACAGCTAA No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data
1113709459_1113709468 17 Left 1113709459 13:112454114-112454136 CCAAGGGCAACCACACAGCTAAG No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data
1113709456_1113709468 30 Left 1113709456 13:112454101-112454123 CCCACTGTGGTTCCCAAGGGCAA No data
Right 1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113709468 Original CRISPR GAGCTTGGGCCCCTGGAGTG AGG Intergenic