ID: 1113709964

View in Genome Browser
Species Human (GRCh38)
Location 13:112456740-112456762
Sequence CAGAACCCTGCATTGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113709964_1113709967 -10 Left 1113709964 13:112456740-112456762 CCCCAAATCAATGCAGGGTTCTG No data
Right 1113709967 13:112456753-112456775 CAGGGTTCTGCTACAGAAAGAGG No data
1113709964_1113709969 -3 Left 1113709964 13:112456740-112456762 CCCCAAATCAATGCAGGGTTCTG No data
Right 1113709969 13:112456760-112456782 CTGCTACAGAAAGAGGAAGGAGG No data
1113709964_1113709970 8 Left 1113709964 13:112456740-112456762 CCCCAAATCAATGCAGGGTTCTG No data
Right 1113709970 13:112456771-112456793 AGAGGAAGGAGGACAGCGAATGG No data
1113709964_1113709968 -6 Left 1113709964 13:112456740-112456762 CCCCAAATCAATGCAGGGTTCTG No data
Right 1113709968 13:112456757-112456779 GTTCTGCTACAGAAAGAGGAAGG No data
1113709964_1113709973 14 Left 1113709964 13:112456740-112456762 CCCCAAATCAATGCAGGGTTCTG No data
Right 1113709973 13:112456777-112456799 AGGAGGACAGCGAATGGGGTAGG No data
1113709964_1113709972 10 Left 1113709964 13:112456740-112456762 CCCCAAATCAATGCAGGGTTCTG No data
Right 1113709972 13:112456773-112456795 AGGAAGGAGGACAGCGAATGGGG No data
1113709964_1113709971 9 Left 1113709964 13:112456740-112456762 CCCCAAATCAATGCAGGGTTCTG No data
Right 1113709971 13:112456772-112456794 GAGGAAGGAGGACAGCGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113709964 Original CRISPR CAGAACCCTGCATTGATTTG GGG (reversed) Intergenic
No off target data available for this crispr