ID: 1113710560

View in Genome Browser
Species Human (GRCh38)
Location 13:112461728-112461750
Sequence GCGCCTGCCCCCGAGAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710560_1113710567 23 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710567 13:112461774-112461796 AAGCAGAGGGCCCCACCTCTCGG No data
1113710560_1113710565 9 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710565 13:112461760-112461782 GCAGAGAGACAGGGAAGCAGAGG No data
1113710560_1113710568 24 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710568 13:112461775-112461797 AGCAGAGGGCCCCACCTCTCGGG No data
1113710560_1113710566 10 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710566 13:112461761-112461783 CAGAGAGACAGGGAAGCAGAGGG No data
1113710560_1113710562 -1 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710562 13:112461750-112461772 CATGAAGCCTGCAGAGAGACAGG No data
1113710560_1113710563 0 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710563 13:112461751-112461773 ATGAAGCCTGCAGAGAGACAGGG No data
1113710560_1113710569 30 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710569 13:112461781-112461803 GGGCCCCACCTCTCGGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710560 Original CRISPR GCGCCTGCCCCCGAGAGGTG AGG (reversed) Intergenic
No off target data available for this crispr