ID: 1113710561

View in Genome Browser
Species Human (GRCh38)
Location 13:112461733-112461755
Sequence TTCATGCGCCTGCCCCCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710561_1113710569 25 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710569 13:112461781-112461803 GGGCCCCACCTCTCGGGCGCAGG No data
1113710561_1113710566 5 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710566 13:112461761-112461783 CAGAGAGACAGGGAAGCAGAGGG No data
1113710561_1113710562 -6 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710562 13:112461750-112461772 CATGAAGCCTGCAGAGAGACAGG No data
1113710561_1113710563 -5 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710563 13:112461751-112461773 ATGAAGCCTGCAGAGAGACAGGG No data
1113710561_1113710565 4 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710565 13:112461760-112461782 GCAGAGAGACAGGGAAGCAGAGG No data
1113710561_1113710568 19 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710568 13:112461775-112461797 AGCAGAGGGCCCCACCTCTCGGG No data
1113710561_1113710567 18 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710567 13:112461774-112461796 AAGCAGAGGGCCCCACCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710561 Original CRISPR TTCATGCGCCTGCCCCCGAG AGG (reversed) Intergenic