ID: 1113710562

View in Genome Browser
Species Human (GRCh38)
Location 13:112461750-112461772
Sequence CATGAAGCCTGCAGAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710561_1113710562 -6 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710562 13:112461750-112461772 CATGAAGCCTGCAGAGAGACAGG No data
1113710553_1113710562 26 Left 1113710553 13:112461701-112461723 CCTGCAGAGAGTCAGGGAAGCAG No data
Right 1113710562 13:112461750-112461772 CATGAAGCCTGCAGAGAGACAGG No data
1113710560_1113710562 -1 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710562 13:112461750-112461772 CATGAAGCCTGCAGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710562 Original CRISPR CATGAAGCCTGCAGAGAGAC AGG Intergenic
No off target data available for this crispr