ID: 1113710564

View in Genome Browser
Species Human (GRCh38)
Location 13:112461757-112461779
Sequence CTGCTTCCCTGTCTCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710564_1113710568 -5 Left 1113710564 13:112461757-112461779 CCTGCAGAGAGACAGGGAAGCAG No data
Right 1113710568 13:112461775-112461797 AGCAGAGGGCCCCACCTCTCGGG No data
1113710564_1113710575 28 Left 1113710564 13:112461757-112461779 CCTGCAGAGAGACAGGGAAGCAG No data
Right 1113710575 13:112461808-112461830 CGAAGCCTGCTGCAGTCTAAGGG No data
1113710564_1113710569 1 Left 1113710564 13:112461757-112461779 CCTGCAGAGAGACAGGGAAGCAG No data
Right 1113710569 13:112461781-112461803 GGGCCCCACCTCTCGGGCGCAGG No data
1113710564_1113710574 27 Left 1113710564 13:112461757-112461779 CCTGCAGAGAGACAGGGAAGCAG No data
Right 1113710574 13:112461807-112461829 ACGAAGCCTGCTGCAGTCTAAGG No data
1113710564_1113710567 -6 Left 1113710564 13:112461757-112461779 CCTGCAGAGAGACAGGGAAGCAG No data
Right 1113710567 13:112461774-112461796 AAGCAGAGGGCCCCACCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710564 Original CRISPR CTGCTTCCCTGTCTCTCTGC AGG (reversed) Intergenic