ID: 1113710565

View in Genome Browser
Species Human (GRCh38)
Location 13:112461760-112461782
Sequence GCAGAGAGACAGGGAAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710561_1113710565 4 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710565 13:112461760-112461782 GCAGAGAGACAGGGAAGCAGAGG No data
1113710560_1113710565 9 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710565 13:112461760-112461782 GCAGAGAGACAGGGAAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710565 Original CRISPR GCAGAGAGACAGGGAAGCAG AGG Intergenic
No off target data available for this crispr