ID: 1113710567

View in Genome Browser
Species Human (GRCh38)
Location 13:112461774-112461796
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710561_1113710567 18 Left 1113710561 13:112461733-112461755 CCTCTCGGGGGCAGGCGCATGAA No data
Right 1113710567 13:112461774-112461796 AAGCAGAGGGCCCCACCTCTCGG No data
1113710560_1113710567 23 Left 1113710560 13:112461728-112461750 CCTCACCTCTCGGGGGCAGGCGC No data
Right 1113710567 13:112461774-112461796 AAGCAGAGGGCCCCACCTCTCGG No data
1113710564_1113710567 -6 Left 1113710564 13:112461757-112461779 CCTGCAGAGAGACAGGGAAGCAG No data
Right 1113710567 13:112461774-112461796 AAGCAGAGGGCCCCACCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710567 Original CRISPR AAGCAGAGGGCCCCACCTCT CGG Intergenic