ID: 1113710575

View in Genome Browser
Species Human (GRCh38)
Location 13:112461808-112461830
Sequence CGAAGCCTGCTGCAGTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710571_1113710575 0 Left 1113710571 13:112461785-112461807 CCCACCTCTCGGGCGCAGGCACA No data
Right 1113710575 13:112461808-112461830 CGAAGCCTGCTGCAGTCTAAGGG No data
1113710572_1113710575 -1 Left 1113710572 13:112461786-112461808 CCACCTCTCGGGCGCAGGCACAC No data
Right 1113710575 13:112461808-112461830 CGAAGCCTGCTGCAGTCTAAGGG No data
1113710573_1113710575 -4 Left 1113710573 13:112461789-112461811 CCTCTCGGGCGCAGGCACACGAA No data
Right 1113710575 13:112461808-112461830 CGAAGCCTGCTGCAGTCTAAGGG No data
1113710570_1113710575 1 Left 1113710570 13:112461784-112461806 CCCCACCTCTCGGGCGCAGGCAC No data
Right 1113710575 13:112461808-112461830 CGAAGCCTGCTGCAGTCTAAGGG No data
1113710564_1113710575 28 Left 1113710564 13:112461757-112461779 CCTGCAGAGAGACAGGGAAGCAG No data
Right 1113710575 13:112461808-112461830 CGAAGCCTGCTGCAGTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710575 Original CRISPR CGAAGCCTGCTGCAGTCTAA GGG Intergenic