ID: 1113710987

View in Genome Browser
Species Human (GRCh38)
Location 13:112465412-112465434
Sequence GTGGCTCCAAACGCCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113710987_1113710995 -1 Left 1113710987 13:112465412-112465434 CCAGGAAAGGCGTTTGGAGCCAC No data
Right 1113710995 13:112465434-112465456 CAGCCACCAGGTGGGCGTGGGGG No data
1113710987_1113710989 -10 Left 1113710987 13:112465412-112465434 CCAGGAAAGGCGTTTGGAGCCAC No data
Right 1113710989 13:112465425-112465447 TTGGAGCCACAGCCACCAGGTGG No data
1113710987_1113710994 -2 Left 1113710987 13:112465412-112465434 CCAGGAAAGGCGTTTGGAGCCAC No data
Right 1113710994 13:112465433-112465455 ACAGCCACCAGGTGGGCGTGGGG No data
1113710987_1113710990 -9 Left 1113710987 13:112465412-112465434 CCAGGAAAGGCGTTTGGAGCCAC No data
Right 1113710990 13:112465426-112465448 TGGAGCCACAGCCACCAGGTGGG No data
1113710987_1113710993 -3 Left 1113710987 13:112465412-112465434 CCAGGAAAGGCGTTTGGAGCCAC No data
Right 1113710993 13:112465432-112465454 CACAGCCACCAGGTGGGCGTGGG No data
1113710987_1113710992 -4 Left 1113710987 13:112465412-112465434 CCAGGAAAGGCGTTTGGAGCCAC No data
Right 1113710992 13:112465431-112465453 CCACAGCCACCAGGTGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113710987 Original CRISPR GTGGCTCCAAACGCCTTTCC TGG (reversed) Intergenic
No off target data available for this crispr