ID: 1113711041

View in Genome Browser
Species Human (GRCh38)
Location 13:112465835-112465857
Sequence TCTCCGCTCGCGGGTTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113711041_1113711047 -9 Left 1113711041 13:112465835-112465857 CCACAAGAACCCGCGAGCGGAGA No data
Right 1113711047 13:112465849-112465871 GAGCGGAGACACGGGGCACCAGG No data
1113711041_1113711051 22 Left 1113711041 13:112465835-112465857 CCACAAGAACCCGCGAGCGGAGA No data
Right 1113711051 13:112465880-112465902 GAAGAGCAGAGCGCCAGGCACGG No data
1113711041_1113711053 26 Left 1113711041 13:112465835-112465857 CCACAAGAACCCGCGAGCGGAGA No data
Right 1113711053 13:112465884-112465906 AGCAGAGCGCCAGGCACGGAGGG No data
1113711041_1113711050 17 Left 1113711041 13:112465835-112465857 CCACAAGAACCCGCGAGCGGAGA No data
Right 1113711050 13:112465875-112465897 ACTCTGAAGAGCAGAGCGCCAGG No data
1113711041_1113711052 25 Left 1113711041 13:112465835-112465857 CCACAAGAACCCGCGAGCGGAGA No data
Right 1113711052 13:112465883-112465905 GAGCAGAGCGCCAGGCACGGAGG No data
1113711041_1113711048 -6 Left 1113711041 13:112465835-112465857 CCACAAGAACCCGCGAGCGGAGA No data
Right 1113711048 13:112465852-112465874 CGGAGACACGGGGCACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113711041 Original CRISPR TCTCCGCTCGCGGGTTCTTG TGG (reversed) Intergenic
No off target data available for this crispr