ID: 1113711843

View in Genome Browser
Species Human (GRCh38)
Location 13:112470265-112470287
Sequence CACCTGCAGGGGAAATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113711843_1113711854 22 Left 1113711843 13:112470265-112470287 CCTCCCCATTTCCCCTGCAGGTG No data
Right 1113711854 13:112470310-112470332 CATCTTGCTACCTCCTTCTTGGG No data
1113711843_1113711853 21 Left 1113711843 13:112470265-112470287 CCTCCCCATTTCCCCTGCAGGTG No data
Right 1113711853 13:112470309-112470331 CCATCTTGCTACCTCCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113711843 Original CRISPR CACCTGCAGGGGAAATGGGG AGG (reversed) Intergenic
No off target data available for this crispr