ID: 1113715214

View in Genome Browser
Species Human (GRCh38)
Location 13:112500246-112500268
Sequence ATAAGGCATCTAAGCAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113715213_1113715214 -8 Left 1113715213 13:112500231-112500253 CCACTCATAATTTAAATAAGGCA 0: 1
1: 0
2: 1
3: 19
4: 255
Right 1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG 0: 1
1: 0
2: 0
3: 9
4: 133
1113715212_1113715214 -7 Left 1113715212 13:112500230-112500252 CCCACTCATAATTTAAATAAGGC 0: 1
1: 1
2: 0
3: 14
4: 171
Right 1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113715214 Original CRISPR ATAAGGCATCTAAGCAAACT AGG Intronic
900923943 1:5691505-5691527 ATAATGTATCTCAGCAAACGGGG + Intergenic
901120135 1:6884706-6884728 ATAAGGCATCCAAGAACACAGGG - Intronic
901583516 1:10266093-10266115 ATCAGACTTCTAAGCAAACAAGG - Intronic
905037207 1:34925929-34925951 ATAAGGCACCCAAGAAATCTGGG - Intronic
905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG + Intergenic
909008965 1:70310945-70310967 ATAAGGCATAAAAGCAAGATGGG + Intronic
912758297 1:112343216-112343238 CTGAGCCATCTAAGCAACCTTGG + Intergenic
913029287 1:114882627-114882649 ATAAGGCACACAAGCAAACAAGG - Intronic
914292904 1:146291470-146291492 ATTTGGCATCTATGTAAACTTGG - Intergenic
914553948 1:148742253-148742275 ATTTGGCATCTATGTAAACTTGG - Intergenic
919240008 1:194902486-194902508 ATCAGGCATCCAGGCATACTAGG + Intergenic
920642388 1:207765270-207765292 ATAAAACTTCTCAGCAAACTAGG + Intronic
922067341 1:222157102-222157124 TTAAGGCATCTTAGGAGACTGGG + Intergenic
1063917677 10:10900518-10900540 ATAAAGAATCTCAGCAAACTAGG + Intergenic
1065200528 10:23308793-23308815 ATAATGCATGTAAGCAATTTTGG + Intronic
1065741596 10:28802068-28802090 ATGAGGTAAATAAGCAAACTGGG - Intergenic
1068401791 10:56537105-56537127 ATAATACATTTATGCAAACTGGG + Intergenic
1069138478 10:64795057-64795079 AAAAGGCATTTAAGAAATCTAGG + Intergenic
1071145439 10:82564975-82564997 ATTAGTCATCTAAGCACACAAGG - Intronic
1071172558 10:82884095-82884117 ATAAGAGATATAAGCAAAATGGG + Intronic
1073856423 10:107680142-107680164 CTAAGAACTCTAAGCAAACTAGG + Intergenic
1076169137 10:128305654-128305676 AGATGGTATCCAAGCAAACTGGG + Intergenic
1077657467 11:4034313-4034335 ATAAAGGCTCTCAGCAAACTAGG - Intronic
1081463462 11:43294067-43294089 ATAAAAACTCTAAGCAAACTAGG + Intergenic
1083483709 11:62968128-62968150 ATAAAACTTCTCAGCAAACTAGG + Intronic
1083910011 11:65701624-65701646 ATAAAACCTCTAAACAAACTAGG - Intergenic
1083980971 11:66169218-66169240 ATAAGTCCTCTTAGCAAACTTGG - Intronic
1086233629 11:84599696-84599718 ATAAGGCATAGAAGCTAAATTGG - Intronic
1086911381 11:92476340-92476362 ATAAGCCATCTAAGTACATTTGG + Intronic
1088659780 11:112034131-112034153 ATAAGGCCAAGAAGCAAACTTGG - Intronic
1090138145 11:124221689-124221711 AAAAAGCCTCTTAGCAAACTAGG - Intergenic
1092949851 12:13491470-13491492 ATAAGGCATCAAAGAAATCCTGG + Intergenic
1093598619 12:20993481-20993503 ATATGGCATATAATGAAACTGGG - Intergenic
1094027003 12:25969692-25969714 ACAAGGCAGCAAAGAAAACTTGG - Intronic
1097957246 12:65498640-65498662 GTAAGAAATCTTAGCAAACTTGG + Intergenic
1098199532 12:68040032-68040054 ATTAGTCAGCTAAGCAAACAGGG - Intergenic
1099576206 12:84385427-84385449 ATAAATAATCTCAGCAAACTAGG - Intergenic
1102319784 12:111922359-111922381 ATAAAGCCTCTCAGCAAACTAGG + Intergenic
1105763650 13:23536690-23536712 ATAAATAATCTAAGCAAAGTAGG - Intergenic
1106062005 13:26302472-26302494 ATAGGGCAGCTAAGGAAATTGGG + Intronic
1107465861 13:40649686-40649708 ATAAGGCATACAATCAAATTAGG + Intronic
1109898885 13:68735822-68735844 ATAAAACCTCTCAGCAAACTAGG - Intergenic
1112930300 13:104727308-104727330 ATAAGAAATCTCAGCAAATTAGG + Intergenic
1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG + Intronic
1116834479 14:49757071-49757093 ATAAGAACTCTCAGCAAACTAGG - Intergenic
1117024069 14:51601948-51601970 ATAAGTCATCTTAGCCTACTTGG + Intronic
1118537678 14:66786835-66786857 ATAAGAACTCTCAGCAAACTAGG + Intronic
1120345863 14:83289326-83289348 ATAAGGAATTTAAGCATTCTTGG - Intergenic
1127025993 15:54807258-54807280 ATAAAGCATCTAAGCAATACAGG + Intergenic
1129629903 15:77247374-77247396 ATAAATAATCTCAGCAAACTAGG - Intronic
1140283570 16:73578465-73578487 TTAAAGCCTCTGAGCAAACTAGG - Intergenic
1145224409 17:21116134-21116156 ATAGGGCAGCTCAGCAAGCTTGG - Intergenic
1152680121 17:81663325-81663347 ATAAGAAATCTAAGAAAACAAGG - Intergenic
1154392393 18:13950602-13950624 ATAAAACCTCTCAGCAAACTAGG - Intergenic
1158048453 18:53186341-53186363 GTAGGGCATATAACCAAACTAGG - Intronic
1163323855 19:16590463-16590485 ATAAAACCTCTCAGCAAACTAGG - Intronic
1163952368 19:20601594-20601616 AAAAGGCATTGAAGTAAACTTGG + Intronic
1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG + Intronic
926437241 2:12850615-12850637 ATAAGGCATTTAATCAGAATGGG - Intergenic
927108671 2:19848863-19848885 ATTAATCATCTAAGCAAACATGG + Intergenic
927647882 2:24890005-24890027 ATAATACCTCTCAGCAAACTAGG - Intronic
930854964 2:56005325-56005347 AAAAAGAATCTCAGCAAACTAGG - Intergenic
932394814 2:71435712-71435734 ATAAGACATCTAAAAAAAGTAGG - Intergenic
935381746 2:102459042-102459064 ATAAAACCTCTCAGCAAACTAGG + Intergenic
935459061 2:103307182-103307204 ATGAGACATATAAACAAACTTGG - Intergenic
937245576 2:120490369-120490391 ATAAAGACTCTTAGCAAACTAGG + Intergenic
939188567 2:138888480-138888502 ATAAGGCATCTAAAAACACTTGG - Intergenic
941102935 2:161317287-161317309 AAAAGGCATATAAGAAAACGTGG - Intronic
944029587 2:195218416-195218438 AAAAAGAAACTAAGCAAACTAGG - Intergenic
944151071 2:196559398-196559420 GTAAGACATCTAAGAAAGCTAGG + Intronic
946253732 2:218429109-218429131 TTAAGGCATGTAAGGAAACCAGG - Intronic
946838939 2:223800647-223800669 ATAAAACTTCTTAGCAAACTAGG + Intronic
1169876325 20:10301047-10301069 ATAATGCATCAAAGCCAATTAGG + Intronic
1170009402 20:11705060-11705082 ATAAGGCATATAAACAAACAGGG + Intergenic
1170260055 20:14394763-14394785 ATAAAACTTCTCAGCAAACTTGG - Intronic
1170302705 20:14903339-14903361 ATAAGTCATGTAAGAAACCTGGG - Intronic
1170722295 20:18893629-18893651 ATAAAACCTCTCAGCAAACTAGG + Intergenic
1175867431 20:62187071-62187093 ACAAAACATCTCAGCAAACTGGG - Intronic
1176251869 20:64128619-64128641 ATAAAGACTCTCAGCAAACTAGG - Intergenic
1181461448 22:23088480-23088502 AAAAGGCGTCTCAGCAAACTGGG + Intronic
1182291386 22:29282672-29282694 ATAAGTCATCTGACCATACTTGG + Intronic
954488308 3:50875482-50875504 ATAAAACCTCTAAACAAACTGGG - Intronic
956141607 3:66152013-66152035 ACAGGGCATCTAATCAAATTAGG + Intronic
959001483 3:100969301-100969323 ATATGTCATCTAACCACACTTGG - Intronic
959301543 3:104608547-104608569 ATAAGGAATCTCAGTAAACTAGG + Intergenic
961576368 3:127840096-127840118 ATAAGGCAAATAAACAAATTTGG + Intergenic
962338324 3:134558835-134558857 AGAAGGCACCTAACCTAACTAGG - Intronic
963443081 3:145366329-145366351 ATAAGCCAACTAAGAAAACAAGG + Intergenic
964546767 3:157842820-157842842 ATAATGCATCTGAGCAATATAGG + Intergenic
966039731 3:175467303-175467325 ATAAGCCATCTCAGCAAATTAGG - Intronic
969692880 4:8715052-8715074 ATAAGAACTCTCAGCAAACTAGG - Intergenic
980801578 4:137757896-137757918 AAAAAGGATATAAGCAAACTGGG - Intergenic
981746139 4:148054288-148054310 ATAAGTGATTTAAGCAAACCAGG + Intronic
981935181 4:150231918-150231940 ACTAGGCATATAAGAAAACTTGG - Intronic
982146409 4:152399277-152399299 AGAAGGACTCTTAGCAAACTAGG + Intronic
982889350 4:160827323-160827345 ATAAAACTTCTAAGCAAACCAGG + Intergenic
984200698 4:176717256-176717278 AAAAGGCATTTAAGCAAGGTTGG + Intronic
984282263 4:177685060-177685082 ATATGGCTTTTATGCAAACTAGG + Intergenic
984591088 4:181618553-181618575 CTAAGGCTTCTAAGCCAATTTGG + Intergenic
984697301 4:182792095-182792117 ATTAAGCATCCAAGCAAATTAGG + Intronic
987717479 5:21590965-21590987 ACTTGACATCTAAGCAAACTGGG + Intergenic
995599711 5:113781982-113782004 ATAAGGAATCTAAGAAAACGAGG + Intergenic
997617422 5:135259108-135259130 ATAAGAACTCTCAGCAAACTAGG + Intronic
1000889114 5:166783395-166783417 ATAATTCATCTCAGGAAACTGGG - Intergenic
1003136655 6:3439519-3439541 AAATGGCAACTAATCAAACTTGG - Intronic
1003326052 6:5091867-5091889 ATAAGACATTTAAGGAAATTGGG + Intergenic
1004219362 6:13732441-13732463 ATAAGGCTACTCAGCACACTAGG - Intergenic
1004521265 6:16363068-16363090 ATAAGGGATCTGAGAAAAGTAGG - Intronic
1010714050 6:79207690-79207712 ATAAGGAATCAAAGCAAAAATGG - Intronic
1010770633 6:79825409-79825431 GTATTGCATCTCAGCAAACTAGG + Intergenic
1011081493 6:83494886-83494908 ATAAAAACTCTAAGCAAACTAGG - Intergenic
1012580162 6:100858494-100858516 ATAAAAAATCTCAGCAAACTAGG - Intronic
1016755477 6:147680690-147680712 ATAAAAACTCTAAGCAAACTAGG - Intronic
1021230490 7:18081967-18081989 ATAATTCTTCTAAGGAAACTTGG - Intergenic
1022795962 7:33731574-33731596 ATAAGGGATCTTTGCAATCTGGG - Intergenic
1023524172 7:41081558-41081580 ATAAGGCCTCTAAGCGTCCTAGG - Intergenic
1027746925 7:82087592-82087614 ATAAAGCATCAAAGCCAACAAGG + Intronic
1030549551 7:110940580-110940602 ATTAGGCAGCTATGGAAACTTGG + Intronic
1031563056 7:123261550-123261572 ATAAGGAACCTAATCAAAGTAGG - Intergenic
1031754016 7:125614442-125614464 ATAAAGCCTCTCAACAAACTAGG - Intergenic
1032228495 7:130053522-130053544 ATAAGTCATCTATGAAAAGTGGG - Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1041478606 8:58293774-58293796 ATAAAGCCTATTAGCAAACTAGG - Intergenic
1041661744 8:60407661-60407683 ATAAGGCATTTGAGCAAAAATGG + Intergenic
1043066753 8:75581627-75581649 ATAAAAACTCTAAGCAAACTAGG + Intergenic
1044012947 8:87017243-87017265 ATAAGGCATTTAAGTAAAAGTGG - Intronic
1047009564 8:120656563-120656585 ATAAGGCATCTAAATAGACAAGG + Intronic
1048297623 8:133226115-133226137 ATAAAGCATCAAAGAAAATTGGG + Intronic
1051556324 9:18386620-18386642 ATAAGGAATAAAAGCAAATTTGG - Intergenic
1052045129 9:23785011-23785033 TTGGGGCATCTAAGCAAACCAGG + Intronic
1055240909 9:74184396-74184418 AGAAACAATCTAAGCAAACTGGG + Intergenic
1055519541 9:77066528-77066550 ATAAGAACTCTCAGCAAACTAGG - Intergenic
1057774480 9:97995491-97995513 AGAAGGAAACTAATCAAACTTGG + Intronic
1186743707 X:12544428-12544450 TTAAGGCATCTGCACAAACTTGG - Intronic
1186775255 X:12858089-12858111 TTAAGGCATCTGCACAAACTTGG + Intergenic
1187855078 X:23628936-23628958 TTCAGGCATCTAGTCAAACTGGG - Intergenic
1188482611 X:30650781-30650803 ATAAGGCATTTGAGCATTCTCGG - Intergenic
1190388230 X:49905153-49905175 AAAAAACATCTCAGCAAACTAGG + Intergenic
1191101400 X:56732763-56732785 ATAAAACCTCTCAGCAAACTAGG - Intergenic
1193605193 X:83558777-83558799 ATAAGGAAACTCAGAAAACTAGG - Intergenic
1194790659 X:98145333-98145355 TAAAGGCATCAAATCAAACTAGG - Intergenic
1198811284 X:140538783-140538805 ATAAGGCATGACAGAAAACTTGG + Intergenic
1200539051 Y:4436667-4436689 ATATTGCATCTCAACAAACTTGG - Intergenic