ID: 1113716736

View in Genome Browser
Species Human (GRCh38)
Location 13:112514504-112514526
Sequence GCTTTTAAAATGATTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113716736 Original CRISPR GCTTTTAAAATGATTGATGA GGG (reversed) Intronic
900080217 1:851205-851227 CTTTTTAAAAAGGTTGATGAGGG - Intergenic
902056684 1:13606504-13606526 GCTTTTAAAAAGATGGAAGTTGG + Intronic
904202355 1:28829147-28829169 GCTTTAAAGATCACTGATGAAGG - Intronic
905675563 1:39822358-39822380 GCTTTCAAAATTATTCATGCGGG + Intergenic
907213035 1:52839517-52839539 GCTTTTAAAATTATTGTTATTGG - Intergenic
907736065 1:57113413-57113435 GCTTTTAAAATTCTAGATTAGGG + Intronic
909050721 1:70764866-70764888 ACTTTTAAAATGACAGAGGAAGG + Intergenic
909179699 1:72406580-72406602 GATTTTCAAATTATAGATGATGG - Intergenic
909470260 1:76019912-76019934 GCTTTTAAACTGTTTGCTGCTGG - Intergenic
909731481 1:78896982-78897004 GCATTTAAACAGAGTGATGAGGG - Intronic
909787879 1:79639390-79639412 TCATTTAGAATGATTGGTGATGG + Intergenic
909792587 1:79696996-79697018 TCATTTAGAATGATTGGTGATGG + Intergenic
910420267 1:87053646-87053668 GCCTTTAAAATGTTTTTTGAAGG - Intronic
910468210 1:87523174-87523196 GCTCTTAAAATGATTGCTTAGGG + Intergenic
910592010 1:88935956-88935978 TCTTATAAAATGATTGTGGAAGG + Exonic
911134055 1:94419869-94419891 GCTTTTAAAAGGATTAATTTGGG + Intronic
911856210 1:102879320-102879342 GATTTTAAAATGACAGATAAAGG - Intronic
912534514 1:110355781-110355803 GCTTTAAAAAAAATTGAGGAGGG - Intergenic
912730079 1:112094489-112094511 GCTTTCATTATGATTGGTGAGGG + Intergenic
913095177 1:115509767-115509789 TCATATAGAATGATTGATGATGG + Intergenic
913097307 1:115531027-115531049 CCTTTTAAACTCATTAATGATGG - Intergenic
915169891 1:153970226-153970248 GCTTTTAAAATTGTTCATGTTGG - Intronic
916310764 1:163396487-163396509 GCTTTTAAAATCAATCATGTGGG + Intergenic
918202013 1:182276609-182276631 GCTTAGAAAATGATTAAGGAAGG + Intergenic
918645708 1:186902334-186902356 TCGTATAGAATGATTGATGATGG - Intronic
918742570 1:188153741-188153763 GCTTTTATGATGATTGAGGTAGG - Intergenic
920273777 1:204788344-204788366 AACTTAAAAATGATTGATGAAGG + Intergenic
920738476 1:208557605-208557627 GCTTTTAAAATAATCCATGCTGG + Intergenic
921062411 1:211596761-211596783 ACTTTTGAGATGGTTGATGATGG + Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921670946 1:217923442-217923464 GCTTTTAAAATAGTTTATGAAGG + Intergenic
921683215 1:218059030-218059052 GATATCAAAATAATTGATGAGGG - Intergenic
921891098 1:220354526-220354548 GTTTTTAAAGTGAATGATGGTGG + Intergenic
922389308 1:225123118-225123140 GCTTTTAAAATTAATTATAATGG - Intronic
922390825 1:225138966-225138988 GCTTTAAAAATACTTGATTATGG - Intronic
922778995 1:228236157-228236179 TCTTTTAAAATGATACATGTGGG + Intronic
923438070 1:233987609-233987631 ACTTTTAAAATGATTTTTGCTGG + Intronic
923487378 1:234446995-234447017 GCTTTTGAAATGGTTGATTTTGG - Intronic
924311496 1:242748108-242748130 GCATTTAAAAAGAAAGATGAAGG - Intergenic
924447835 1:244150248-244150270 GCTGTTGAACTGATGGATGAGGG - Intergenic
924610921 1:245573225-245573247 GCTTTTAAAATTAATGAGGCCGG + Intronic
1063102231 10:2960732-2960754 ACTTTTAAAAAGATTACTGATGG + Intergenic
1064082499 10:12319925-12319947 GCTTTTGGATTGATTGATAATGG - Intergenic
1064854902 10:19755099-19755121 GCTTTTAAAATAAATCAGGAAGG + Intronic
1066138071 10:32471642-32471664 GCTGTTAATATAATTAATGAAGG - Intronic
1066209007 10:33218229-33218251 GCTTTATAGGTGATTGATGAAGG - Intronic
1072056108 10:91757742-91757764 ACTTTTAACAGGTTTGATGATGG - Intergenic
1073003528 10:100303482-100303504 ACTTTTAAAATGTTTGATGTGGG - Intronic
1073342020 10:102752465-102752487 GTTTTCAAAATGTTTGATGTTGG - Intronic
1073436634 10:103520866-103520888 TCTTATAGAATGATTGGTGATGG + Intronic
1073951507 10:108814596-108814618 GCTTTCAAAATGAGTTTTGATGG - Intergenic
1074837106 10:117306385-117306407 TCTTTTACAATGATTGATGTTGG + Intronic
1075244483 10:120808759-120808781 TCTATTAAAATGAATGATAATGG + Intergenic
1076418553 10:130310586-130310608 GCTCTTCAAATGATGGATAAGGG - Intergenic
1077510345 11:2956892-2956914 GCTTTGAAAAAAATTGAGGATGG - Intronic
1079172151 11:18106287-18106309 GCTCTTAGACTGATTGAAGAAGG + Intergenic
1079932798 11:26586149-26586171 GCTTTAAAAAGTACTGATGATGG + Intronic
1080122718 11:28695908-28695930 GCTCCAAGAATGATTGATGAAGG - Intergenic
1080505568 11:32909754-32909776 GCTTTTAAAATAAATGTTAAAGG - Intronic
1082030117 11:47597739-47597761 GCTATTAAAATTATTGTTGTTGG - Intergenic
1082197234 11:49321174-49321196 TCATATAAAATGATTGCTGATGG + Intergenic
1082198148 11:49328143-49328165 GCTTTTACTTTGATTGATAAAGG + Intergenic
1082670261 11:56026866-56026888 GTTCTTTAAATGATTGATGATGG - Intergenic
1082750880 11:57015485-57015507 GTTTTTAAAATGATGATTGAGGG + Intergenic
1085087552 11:73680730-73680752 GCTTTTCTAATGAACGATGAAGG - Intronic
1085161326 11:74349152-74349174 GCTAATCAAATGGTTGATGAAGG - Intronic
1085499212 11:77003254-77003276 GCTATTCAAATGATTGATTTTGG + Intronic
1085544496 11:77304485-77304507 GCTGTTAAAATCAGTAATGAAGG + Intergenic
1086318455 11:85618460-85618482 GTTTTTAAAATGTTGGATTAAGG - Intronic
1086472706 11:87132570-87132592 TCTTTTAATATGCTTAATGAAGG + Intronic
1086487008 11:87316373-87316395 GCTTTTAAAATCCTACATGATGG - Intronic
1086657664 11:89380002-89380024 GCTTTTACTTTGATTGATAAAGG - Intronic
1086658585 11:89386946-89386968 TCGTATAAAATGATTGGTGAGGG - Intronic
1086730176 11:90239481-90239503 TCTTTTAAAATTAAAGATGAGGG - Intergenic
1089267442 11:117275198-117275220 TTTTTAAAAATGATTGATAACGG + Intronic
1089385510 11:118064940-118064962 GCGTTTAATATTAGTGATGAAGG - Intergenic
1089761143 11:120724493-120724515 GTTTTTACAATGATTGGAGAAGG + Intronic
1089988065 11:122832166-122832188 TCATTTAGAATTATTGATGATGG - Intergenic
1090570523 11:128039716-128039738 GCTTTAGAAATGATGGATGGTGG - Intergenic
1090589533 11:128250565-128250587 ACTTATAAAATAATTGGTGAGGG + Intergenic
1090816808 11:130304854-130304876 GCTTTTCAAATGAATCTTGAGGG - Intronic
1091179650 11:133592245-133592267 ACTTTTAAAATGATCCATGGAGG - Intergenic
1091436300 12:475661-475683 GGTTCTAAAATAATTGAGGAAGG - Intronic
1093073289 12:14729963-14729985 GCTTTTAAAATTATTGCTGTAGG + Intergenic
1093253984 12:16842767-16842789 TCTTTTAAATTGGTTGCTGAAGG + Intergenic
1093351841 12:18112524-18112546 GCTTTTAAAATTGTTGTTGCAGG - Intronic
1093414024 12:18899657-18899679 ACTTATAAAATGATTATTGATGG - Intergenic
1094190280 12:27690809-27690831 ACTTTAAAAATGATTGAAGGTGG + Intronic
1094371754 12:29746129-29746151 GATTTTAAAATGAGGGATGTGGG + Intronic
1094725818 12:33114923-33114945 GCTTTTAAAATTAGAGCTGAGGG + Intergenic
1094826522 12:34273513-34273535 TCGTATAAAATGATTGGTGATGG - Intergenic
1095551981 12:43453388-43453410 CCTTTTAAATAGTTTGATGAGGG + Intronic
1097156334 12:57014921-57014943 GCTTTTAAGATGATTGCGGGTGG - Intronic
1097474710 12:60039208-60039230 GCTTTTAAGATGATTTATTTGGG - Intergenic
1097626404 12:62006803-62006825 GATATTAAAATGGTTGATGGGGG - Intronic
1098667964 12:73188186-73188208 TCTTCTAAAATGACTGATTATGG + Intergenic
1099509857 12:83520845-83520867 GCATTTAGCATGATTGATAATGG - Intergenic
1100133510 12:91525316-91525338 GCTTTGAGAATGATTTAAGAAGG + Intergenic
1100561746 12:95754211-95754233 TCTTATAGAATGATTGGTGATGG - Intronic
1102097025 12:110249090-110249112 GCTTTTGAGGTGATAGATGAGGG + Intergenic
1102613435 12:114132446-114132468 GCTTTGAAAAAGATTGGAGATGG - Intergenic
1102763799 12:115413582-115413604 GCTTTGAAAAAGAATGAAGAGGG - Intergenic
1103052972 12:117796918-117796940 GCTTGTTAAATGAGTGATCAGGG - Intronic
1103292419 12:119857830-119857852 GATTTTATAATTATTCATGATGG - Intronic
1104258078 12:127157343-127157365 TCTTATAGAATGATTGGTGATGG - Intergenic
1105612433 13:21980761-21980783 GCTTTCAGAAAGATTGATGATGG + Intergenic
1107373668 13:39779099-39779121 GCTTTTAAATAGATTGCTCAAGG - Intronic
1108281583 13:48867314-48867336 TCTTATAGAATGATTGGTGATGG + Intergenic
1108415125 13:50190215-50190237 GCTTCTAAAATTAGTGATAAGGG - Intronic
1108761852 13:53576872-53576894 TCTTTTAAAAAGATTCATGTTGG - Intergenic
1110522484 13:76497064-76497086 GCTTTTAAACTGATGTATAAAGG - Intergenic
1110897533 13:80773826-80773848 CCTTTTCTAATGATTGAGGAAGG - Intergenic
1111093392 13:83476509-83476531 ACTTTTAAGATGATAAATGAAGG + Intergenic
1111121167 13:83851535-83851557 TATTTTAAAATGATTGATAAAGG - Intergenic
1111147837 13:84207644-84207666 GTTATTATAATGATTGATCATGG + Intergenic
1112391208 13:98985890-98985912 GCTTCTAGAATAAATGATGAAGG + Intronic
1113716736 13:112514504-112514526 GCTTTTAAAATGATTGATGAGGG - Intronic
1113746819 13:112750903-112750925 GCTCTATAAATGTTTGATGAAGG - Intronic
1114942987 14:27639205-27639227 GTTTTCAAAATACTTGATGAAGG - Intergenic
1115022190 14:28695714-28695736 GCATTTGAAGTGATTGATGGTGG - Intergenic
1115057020 14:29140946-29140968 GATTTTAATGTGCTTGATGAAGG - Intergenic
1117019343 14:51553431-51553453 ACATTTAAAATGCTTTATGAGGG + Intronic
1117750611 14:58919001-58919023 ACTTTTAAAATTATAGAGGAAGG + Intergenic
1118057493 14:62095855-62095877 GCTTTTAAAAAGATGGTAGAGGG + Intronic
1119140109 14:72259605-72259627 GGTTTAAAAATGCTTAATGAGGG + Intronic
1119297829 14:73547509-73547531 CCCTTTAAAATTATTCATGATGG - Intronic
1119302123 14:73579717-73579739 CCCTTTAAAATTATTCATGATGG - Intergenic
1119534182 14:75388083-75388105 GTTTTTATAATGAATGGTGATGG - Intergenic
1119915535 14:78397911-78397933 GCTTTTAAAATGACTGTTTTAGG + Intronic
1120520970 14:85528201-85528223 GCTTTAGAAATGTGTGATGATGG - Intergenic
1120929158 14:89830848-89830870 GCTTTTAAAATGATTTTTAAAGG - Intronic
1122528916 14:102411041-102411063 TCATATAGAATGATTGATGATGG - Intronic
1125629704 15:41137189-41137211 TCGTATAGAATGATTGATGATGG - Intergenic
1125775950 15:42213722-42213744 GCTATCAGAATGATTGATGAGGG + Intronic
1128815007 15:70602005-70602027 TCTTTTATATTGACTGATGAGGG + Intergenic
1128952836 15:71905328-71905350 ACTTTTAAAATGATTCAGGAGGG + Intronic
1129943018 15:79514706-79514728 GGTTTTAAAATGATAAATGTTGG + Intergenic
1130212441 15:81937320-81937342 ACTTTTTAAATGGTTGATAACGG - Intergenic
1130789912 15:87143192-87143214 GTTTTAAAAATGAGTAATGAGGG + Intergenic
1131865512 15:96704503-96704525 GCCTTAAAAATGTGTGATGATGG - Intergenic
1134745751 16:16587035-16587057 CCTTTAAAAGTGATTGATTAAGG - Intergenic
1135169456 16:20170400-20170422 TCTTTTACATTGTTTGATGAAGG + Intergenic
1137399519 16:48141940-48141962 GCTATGAAAGTGATGGATGATGG + Intronic
1137863935 16:51874306-51874328 GTTTTAAAAATGATTTATAATGG - Intergenic
1139710765 16:68774222-68774244 AGTTTTAAAATGTTTGTTGATGG + Intronic
1140564407 16:76024293-76024315 CCTTTCAAAATTATTGATAAAGG + Intergenic
1142556982 17:785778-785800 AATTTTAAAATGAGTGATAAAGG + Intronic
1142728504 17:1833878-1833900 ACTTTTAAAAAGACTGATCATGG + Intronic
1149617916 17:58017174-58017196 GCTCTTAAAATGATCTATTATGG + Intergenic
1150180285 17:63112064-63112086 TCTTTTAAAATTATTGACCATGG + Intronic
1150419080 17:65014720-65014742 CCTTTCAAAATGGTTGATGTAGG - Exonic
1153333663 18:3900180-3900202 GCTTATAAAATAATTGAACAGGG + Intronic
1155848929 18:30745692-30745714 GCTTTTGAAATAACAGATGAAGG - Intergenic
1155927281 18:31670352-31670374 GCCTTTAAAATGATTTTTTATGG + Intronic
1156050998 18:32934065-32934087 GCTTTTAAACTAATTGCTGTGGG - Intergenic
1156173002 18:34508564-34508586 GGTTTTAAAATGTTTTATGATGG + Intronic
1156958620 18:42996152-42996174 TCATTTAGAATTATTGATGATGG - Intronic
1157045365 18:44096556-44096578 TCTTTCTAACTGATTGATGAAGG + Intergenic
1157183259 18:45516589-45516611 TCTTTTCAAATGAATGATTATGG - Intronic
1157655013 18:49376758-49376780 GCTGTTAAAATGTTAGAAGATGG + Intronic
1158150333 18:54360332-54360354 GTTTTCTAAATCATTGATGAAGG + Intronic
1158336755 18:56420646-56420668 TCATATAGAATGATTGATGATGG - Intergenic
1158761258 18:60390183-60390205 GCTTTTATGATCATTGATGATGG + Intergenic
1158795430 18:60840041-60840063 GCTTTTAAAATGGTTAAAGGTGG - Intergenic
1158910228 18:62053274-62053296 GCTTTTTAAATGGTTGCTGTAGG - Intronic
1159062925 18:63535190-63535212 CATTTGAAAATGTTTGATGAGGG + Intergenic
1159089955 18:63836869-63836891 GCTTTTTTAATGATTGATTTGGG - Intergenic
1159172841 18:64795334-64795356 GCTTTTGAAATGATTCACCATGG + Intergenic
1159304525 18:66623137-66623159 GCTTTTAAAATCTTTTGTGATGG + Intergenic
1159331599 18:67001457-67001479 GCTGTTTAAATGATTCATTATGG - Intergenic
1159409083 18:68046432-68046454 GTTATTAAAATATTTGATGAAGG - Intergenic
1159539254 18:69754800-69754822 GCTTTTAAAGAGCTTAATGAAGG - Intronic
1159627571 18:70712632-70712654 ACTTTAAAAATGATTAATGTGGG + Intergenic
1159722600 18:71911309-71911331 ACTTCTAAAATGATTTATTATGG - Intergenic
1159861485 18:73654462-73654484 GCTTTTAAAATGCTTTCTAAAGG - Intergenic
1160593626 18:79959384-79959406 GATTTTATAATTATTGATGCTGG - Intergenic
1161367726 19:3890561-3890583 GCTTTTAAAATTATCGGTGGAGG - Intronic
1163410305 19:17149813-17149835 GCCTTGAAAATGATTGGGGAAGG + Intronic
1164459008 19:28431846-28431868 TCATTTAGAATGATTGGTGATGG + Intergenic
1168052031 19:53836650-53836672 TCGTATAGAATGATTGATGATGG - Intergenic
925351885 2:3206865-3206887 TCTTTTAAAAAGAATAATGAGGG + Intronic
925465142 2:4100920-4100942 TCTTTTAAAATAATTGAGAAGGG + Intergenic
925548416 2:5042433-5042455 GCTTGTAAAATTTTTGATGTTGG + Intergenic
925548903 2:5048639-5048661 GCTTGTAAAATTTTTGATGTTGG + Intergenic
925690924 2:6522356-6522378 CCTTTTAAAATGACTGAAGTAGG + Intergenic
926508877 2:13748444-13748466 GCAATAAAAATGATTGATAAAGG + Intergenic
927131685 2:20065547-20065569 GCTATTAAATTGAATGGTGAGGG - Intergenic
928263570 2:29789744-29789766 GCGTTTAAAATCATTGATGTGGG + Intronic
928345023 2:30484356-30484378 GCTTTCAAAATGACTGATTTGGG - Intronic
928485350 2:31725452-31725474 GCTTCAAAAATAATTCATGATGG + Intergenic
929051820 2:37843523-37843545 GCTGTTAAAATGATGGATGCCGG - Intergenic
930035990 2:47085537-47085559 CCTTGTAAAATGGTTGTTGAGGG - Intronic
930759441 2:55017410-55017432 CCTTTTAAAGTGAGTGATCATGG + Intronic
932089888 2:68797242-68797264 GCTTGTGAAATGCTTGGTGAGGG + Intronic
932156174 2:69419628-69419650 GATATTAAAATGCTTGATTATGG + Intronic
933179327 2:79211982-79212004 TCATTTAGAATTATTGATGATGG + Intronic
933487376 2:82939619-82939641 GCTACTAAGATCATTGATGACGG - Intergenic
936823381 2:116551966-116551988 GCTTTGAAAATGAGAGATAAAGG - Intergenic
938673502 2:133607031-133607053 TTTTTTAAAAGGATTAATGATGG - Intergenic
939051901 2:137317597-137317619 GCTTTAAAAAGTATTGATGCTGG + Intronic
939335369 2:140820278-140820300 GCTTTTAAAAAAATTAATGTAGG - Intronic
941315529 2:163987434-163987456 GCTCTTAAAATATTTTATGATGG - Intergenic
941373041 2:164691368-164691390 GCTTTTAAAATGATCACAGAAGG + Intronic
941510933 2:166408338-166408360 GCTTTTAAATGGATTGTTGATGG - Intronic
941958552 2:171230061-171230083 GCTTTTCAAATGAATAATTATGG - Intronic
942195818 2:173519101-173519123 TCTTTTAAATGGATTGATGCTGG - Intergenic
942840421 2:180353705-180353727 GCTTTAAAATTGATTGATTCTGG - Intergenic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
943460724 2:188169324-188169346 TCATTTAGAATTATTGATGATGG + Intergenic
944233589 2:197421333-197421355 ACTTTTAAAATGATTAAGCAAGG + Intronic
944700533 2:202241915-202241937 GCTCTAAAATTGATTGGTGATGG + Intergenic
945313604 2:208344854-208344876 GCTTTTAAAATCTTTGTTGAGGG + Intronic
945588536 2:211698014-211698036 GCTTTAAAAAGGAATGAGGAAGG + Intronic
945675254 2:212848243-212848265 ACTTTTAAAATGTTTGATTAGGG - Intergenic
946551078 2:220802564-220802586 GCTTTTAAAGAGATTTTTGAAGG - Intergenic
946601382 2:221363811-221363833 GTTTTAAAAATCATTCATGAAGG - Intergenic
947063689 2:226195990-226196012 GCTTTTAGAAAGAGTAATGATGG + Intergenic
947276619 2:228398945-228398967 TCTTTTAAACTGTTTGATGTAGG + Intergenic
1169431994 20:5544757-5544779 GCTTTTGATCTGAATGATGATGG - Exonic
1169827282 20:9782846-9782868 GCTTTGAAAATGTTTGACGATGG - Intronic
1170027503 20:11906129-11906151 GTTTTTAAAATCATTGCTGGTGG + Intronic
1170452603 20:16499820-16499842 TCTTTTAAAAGGATTTAGGAAGG - Intronic
1170560221 20:17550771-17550793 GCTTTTAAAATGATTGTAGTTGG - Intronic
1172089900 20:32422924-32422946 GCTTTTAAAAAAATTAATAATGG - Intronic
1172263566 20:33590873-33590895 GCTCTTTTAAAGATTGATGAGGG + Intronic
1172932020 20:38593033-38593055 TCATTTAGAATTATTGATGATGG + Intergenic
1173882782 20:46430780-46430802 GGTTTTAAATTGAAGGATGAAGG - Intronic
1175207232 20:57320687-57320709 GATTTTAAAATGTTTTCTGAGGG + Intergenic
1176734311 21:10529605-10529627 GCCTTTTAAAGGATAGATGAGGG + Intronic
1177532674 21:22382315-22382337 GATTTTAAAATAATTTATGTAGG + Intergenic
1177652541 21:23976692-23976714 GCTGTAAAAATGAATGAGGAAGG - Intergenic
1177841638 21:26241030-26241052 TGTTTTAAAATTAATGATGATGG - Intergenic
1179577038 21:42314351-42314373 GCTTTAAAAATGACTGACGTTGG + Intronic
1180395431 22:12328576-12328598 GCTCTTAAAATTAATGTTGAGGG + Intergenic
1180404315 22:12536175-12536197 GCTCTTAAAATTAATGTTGAGGG - Intergenic
1180562053 22:16625086-16625108 GCCTTTTAAAGGATAGATGAGGG + Intergenic
1181294550 22:21825558-21825580 GCCTTTGAAATGATTGTGGAAGG - Intronic
1182192941 22:28482536-28482558 TTTTTTAAAATGCTTGATTAAGG - Intronic
1182596538 22:31425155-31425177 GCTTTTAAATTTAATTATGATGG + Intronic
949644022 3:6072390-6072412 GCTTTTAAAATGATGGGTGGAGG - Intergenic
950356179 3:12411523-12411545 CCTTTTAAAATGATTGTTCTAGG - Intronic
951519142 3:23594927-23594949 ATTTTTAAAAAGATGGATGAGGG - Intergenic
952265407 3:31780946-31780968 GCTTTATAAATGATTTATGGAGG - Intronic
952564720 3:34641132-34641154 TCGTATAGAATGATTGATGATGG + Intergenic
952782555 3:37116435-37116457 GTTTTTAAAATGCTGGTTGAGGG - Intronic
954040349 3:47881973-47881995 GCTTCTAAAATAATTCCTGATGG + Intronic
954867596 3:53743173-53743195 GATTTTAACATAATTGATAAAGG + Intronic
954976581 3:54700983-54701005 GCTTTTAGAATAATTACTGATGG - Intronic
955139038 3:56250653-56250675 GCTTTTAAAATATATAATGAGGG - Intronic
956189372 3:66594156-66594178 GCTTTTAGAAAGAATGAGGAAGG + Intergenic
956233005 3:67038521-67038543 TCATTTAGAATGATTGGTGATGG + Intergenic
957059494 3:75470531-75470553 TCATTTAGAATTATTGATGATGG + Intergenic
957158218 3:76573684-76573706 AGTTTTAAAATCTTTGATGAGGG + Intronic
957220894 3:77380981-77381003 GCTTTAGAAATGAATGGTGATGG - Intronic
957316437 3:78581891-78581913 TCATATAGAATGATTGATGATGG + Intergenic
957687309 3:83518046-83518068 GTTTTTACAATGATTGTTGAGGG - Intergenic
957920349 3:86739695-86739717 GTCTTTAAAATGGTTGAGGAGGG - Intergenic
958443605 3:94187187-94187209 GCTTTTAAAAAAATTGTTTATGG + Intergenic
959374965 3:105578118-105578140 GCTTTGAAAATAATAAATGACGG + Intergenic
959556637 3:107727001-107727023 GCTTTAAAATTGGTTGATGCTGG + Intronic
960312685 3:116135737-116135759 GCTTTTAAAATAAATGAAGGAGG - Intronic
960984579 3:123267383-123267405 GCTTTTTAAATGATTGCTGTAGG + Intronic
961127468 3:124433142-124433164 GCCTTTACAATGATTGTTGGTGG + Intronic
961293908 3:125868848-125868870 TCATTTAGAATTATTGATGATGG - Intergenic
961799160 3:129431650-129431672 GCTTTTTAAATGTTTGCTGGGGG + Intronic
964851679 3:161102759-161102781 GCTTTTAACAGGATGGATCATGG - Intronic
964931163 3:162025090-162025112 GCTTTTAAATTGAGTCTTGAAGG - Intergenic
965235204 3:166109550-166109572 CCTTTAATAATGATTTATGAGGG - Intergenic
965306576 3:167071178-167071200 TCTTTTAATATTTTTGATGAAGG - Intergenic
966252349 3:177880264-177880286 TCTTTTAAAGTGATTGTTCATGG - Intergenic
966438943 3:179922127-179922149 GCTTGTAAGATGATGGATCATGG + Intronic
966622555 3:181981661-181981683 GCATGTAAAATGAATGATAATGG - Intergenic
966705529 3:182909753-182909775 GCTTTTAAAATGCTGAATGTTGG - Intronic
967721220 3:192818617-192818639 CCTTTAAAAATGGTTGAAGATGG - Intronic
967869683 3:194219684-194219706 TCTTTTAACATGATAGTTGAAGG + Intergenic
969861801 4:10041911-10041933 GGTTTCAAAAGGATTGTTGAAGG - Intronic
969963285 4:10968930-10968952 GAATTCAAAATGATTTATGATGG - Intergenic
971206723 4:24577673-24577695 ACTTTTAAAATGACTTATTAAGG - Intronic
971892993 4:32549730-32549752 AACTTTAAAATGATAGATGATGG + Intergenic
972074474 4:35068039-35068061 GTTTTTATAATGATTTATGAAGG + Intergenic
972148140 4:36054897-36054919 CATTTTATAATGATTGGTGATGG + Intronic
972585370 4:40432790-40432812 GCCCCTAAAATGATTGAAGATGG - Exonic
973058636 4:45691589-45691611 TGTATTAGAATGATTGATGATGG - Intergenic
975160981 4:71123272-71123294 GCTTTTAAAATGAATGAAAAAGG + Intergenic
975207120 4:71657912-71657934 CATTTGAAAATGATTGATTAAGG - Intergenic
975368811 4:73560010-73560032 GGTTTTAAAATGATAAATAATGG + Intergenic
975785207 4:77880299-77880321 GCTTTGAAGATGAAGGATGAGGG - Intronic
975864705 4:78714519-78714541 TCATATAGAATGATTGATGATGG + Intergenic
975933497 4:79554642-79554664 TCATATAGAATGATTGATGATGG + Intergenic
978074095 4:104507507-104507529 GTGTTCAAAATGATTGATCATGG - Intergenic
978187453 4:105873044-105873066 GCTTTAAAAATGATTATTGAAGG - Intronic
978358439 4:107902686-107902708 GGTTTGAAAATGATGGATTAGGG - Intronic
979046166 4:115868152-115868174 TCTATTAAAATAAATGATGATGG - Intergenic
979055779 4:115991991-115992013 GCTTTGAAGATGAGTGGTGAAGG + Intergenic
979380326 4:119998974-119998996 TCTTATAGAATGATTGGTGATGG - Intergenic
979582212 4:122373950-122373972 GGTTTTTAAATGAATGATGTTGG - Intergenic
980199338 4:129635316-129635338 GCCTTTCAAATAAATGATGAAGG + Intergenic
980475541 4:133309922-133309944 GCTTATAAAAGGATTGAAGAGGG + Intergenic
980635115 4:135492113-135492135 GCTTTTAAAATGAATAATAGTGG - Intergenic
981104069 4:140860570-140860592 TGTTGTAAAATGATTGATGTTGG - Exonic
981907030 4:149933028-149933050 AGTATTAAAATGAGTGATGATGG - Intergenic
982083561 4:151813108-151813130 TCATTTAGAATGATTGGTGATGG + Intergenic
982405603 4:155016370-155016392 GGCTTTTAAATGAGTGATGAGGG - Intergenic
983086470 4:163451042-163451064 GCTTGTGATATCATTGATGAAGG - Intergenic
983589478 4:169391907-169391929 GCTTATCACTTGATTGATGATGG - Intergenic
984105355 4:175538842-175538864 GCTTATAAATTGTTTGTTGAGGG + Intergenic
984403843 4:179301585-179301607 CCTTATAAAATGAGTGATGCTGG - Intergenic
986150575 5:5126265-5126287 GCTCTTAAGATGATGGAGGAAGG + Intergenic
986333252 5:6733530-6733552 GCTTTAAAAGATATTGATGACGG + Intronic
987962661 5:24830298-24830320 GATTTTAAAATAATTGAACATGG + Intergenic
988101012 5:26678670-26678692 GTTTTTAAAATCCTTGTTGATGG + Intergenic
988458844 5:31413913-31413935 ACTTTTGAAAAGATTGATGTAGG + Intronic
988626915 5:32886861-32886883 GCTTTTTACATGATTAATGAGGG + Intergenic
988943308 5:36168120-36168142 CATTTTAAAATGAATGAAGATGG + Intronic
989064140 5:37442689-37442711 GCTTTAAAAATAATTGTTTAAGG + Intronic
989255930 5:39365673-39365695 GCTTTTAAAAGCATGGATGCAGG - Intronic
990193087 5:53283161-53283183 GCTTTTAAAACGATAAATGCTGG + Intergenic
990910910 5:60851148-60851170 GTTTTCAAAATGATTTATCATGG + Intergenic
991137141 5:63195027-63195049 GCTTTTAAACTTCTTTATGATGG - Intergenic
993118912 5:83751180-83751202 GCTTTTAGAATGATAGAGTAAGG - Intergenic
993689595 5:90983046-90983068 GCTTTAAAAATGATATATTATGG + Intronic
994462011 5:100076636-100076658 GCTTTAAAAATAATTGTTTAAGG - Intergenic
994517422 5:100788176-100788198 CCTACTAAAATAATTGATGAAGG - Intergenic
994896751 5:105715167-105715189 GGTTAAAAAATGATGGATGATGG + Intergenic
996085849 5:119304330-119304352 GCCTTTAATATGTTTGGTGAAGG - Intronic
996141006 5:119909170-119909192 GCTTTTAAAATGAGTCTTTAGGG + Intergenic
996191027 5:120541617-120541639 GGCTTTAAAATGATTGCTCAAGG + Intronic
996218482 5:120897792-120897814 GCTGTTAAAATCATTGATTCAGG - Intergenic
996313759 5:122137861-122137883 GCTCTGAAAAGGATAGATGAGGG + Intronic
998754684 5:145363531-145363553 TATTTTAAAATGATCTATGAGGG - Intergenic
998783642 5:145685549-145685571 GCTTTTGTAATGAGTGTTGAGGG - Intronic
998965659 5:147537815-147537837 GCTTTTGAAATGAAGGATGTAGG - Intergenic
999618484 5:153450358-153450380 TCGTATAGAATGATTGATGATGG + Intergenic
1000568271 5:162879563-162879585 GGCTTTAAAATTATTGATAAAGG - Intergenic
1000783392 5:165512780-165512802 GCTTTAAAAATGATTGATATTGG + Intergenic
1001311752 5:170616105-170616127 GCTTTTCCAATGGCTGATGATGG + Intronic
1002556657 5:180046919-180046941 ATGTTTAACATGATTGATGAAGG + Intronic
1003075948 6:2983763-2983785 TCTTTTAAAATGTTTGTTGCTGG - Intergenic
1004128096 6:12893393-12893415 GCATTTAAAAAAATTGTTGATGG - Intronic
1004404487 6:15319279-15319301 TCTTTTAAAATTATTGTTCAAGG - Intronic
1004929035 6:20443913-20443935 GCTTTTAAAATGACAGAGGCTGG + Intronic
1005583524 6:27254619-27254641 GCTTTGAAAATGATTATTGAAGG + Intronic
1006121826 6:31811674-31811696 CCTTTTCAAGTGATTAATGAAGG - Exonic
1007300188 6:40862046-40862068 TCATATAGAATGATTGATGATGG + Intergenic
1007979441 6:46136012-46136034 GCTTTTAAAATAATACATTATGG + Intronic
1008464017 6:51810169-51810191 GCTTTTAAAAAAATTGATTTGGG + Intronic
1008717463 6:54306393-54306415 GCTGTTAAACTGATTCATGTTGG + Intergenic
1009359752 6:62796797-62796819 TCATTTAGAATTATTGATGATGG - Intergenic
1009585204 6:65592211-65592233 GCTGTTAGAATAATTGATAAAGG - Intronic
1009640766 6:66332641-66332663 GCTTTTAAAATTATTGCAAATGG + Intergenic
1010010890 6:71046932-71046954 GCCTCTAAAGTGATTGCTGATGG - Intergenic
1010010895 6:71047038-71047060 GTTGTTAAAATGATCGCTGAGGG + Intergenic
1011316595 6:86039292-86039314 AATCTTTAAATGATTGATGATGG - Intergenic
1011915515 6:92500944-92500966 GCTTTTCAAATTATTTCTGAAGG - Intergenic
1013843323 6:114423115-114423137 TCTTATAGAATGATTGGTGATGG + Intergenic
1013892098 6:115036922-115036944 TCTTATAGAATGATTGGTGATGG - Intergenic
1014097880 6:117480256-117480278 TTTTTTAAAATGATGCATGATGG - Intronic
1014224280 6:118830115-118830137 GTTTTTAAACTAATTAATGATGG + Intronic
1014454484 6:121621095-121621117 TCTTATAGAATGATTGGTGATGG + Intergenic
1015069061 6:129067399-129067421 ACTTTTAAAATTATTAATAAAGG + Intronic
1015175972 6:130309510-130309532 GCTTTTAAAATCATTGATATCGG + Intronic
1015259301 6:131216860-131216882 GTTTTGAATATGATTGTTGATGG - Intronic
1015591077 6:134823557-134823579 GCTTTTGAAATAATTCATCAGGG + Intergenic
1015845941 6:137520682-137520704 TGCTTTAAAATAATTGATGATGG - Intergenic
1016046819 6:139489485-139489507 CCTTATAAAATGATGGATCAAGG - Intergenic
1016113756 6:140258129-140258151 TCTTTTAGAATTATTGGTGATGG + Intergenic
1016703820 6:147083542-147083564 GTTTTTAAAATAATTGAGCATGG - Intergenic
1016811815 6:148268526-148268548 GCTTTCAAAATGGTAGATGAGGG - Intergenic
1017477154 6:154808594-154808616 GTTTTTAAAAATATTGACGATGG - Intronic
1020924021 7:14301542-14301564 TCTTTTAAAAAGATAGATTAGGG + Intronic
1023177754 7:37449620-37449642 GCTTTGAAAATGATTTAAGTAGG - Intergenic
1024617891 7:51131074-51131096 GCCATTAAAATAAGTGATGATGG - Intronic
1025293579 7:57755100-57755122 TCTCTGAAAATGATTTATGATGG - Intergenic
1028370209 7:90083240-90083262 GCTTTTCACATGAGTGCTGATGG - Intergenic
1028495698 7:91457287-91457309 GCTTTTAATATGAATGAAGGTGG + Intergenic
1028553893 7:92102274-92102296 GCAATTAATATGATTAATGAGGG + Intronic
1028715027 7:93955985-93956007 GCTTTTAAAAATATTAATGCTGG + Intergenic
1031124487 7:117757712-117757734 GTTTTTAAAATGTTTGATTAAGG - Intronic
1031526037 7:122822303-122822325 TCTTATAGAATGATTGGTGATGG - Intronic
1031795603 7:126170679-126170701 GTGTTTAAAATGAAAGATGATGG + Intergenic
1031876250 7:127144413-127144435 CCTTTTCAAATAATTTATGAAGG - Intronic
1035525296 8:307708-307730 CTTTTTAAAAAGGTTGATGAGGG + Intergenic
1035880234 8:3238630-3238652 TCATTTAGAATTATTGATGATGG + Intronic
1036373815 8:8183215-8183237 TCATTTAAAATTATTGGTGATGG - Intergenic
1036471860 8:9059537-9059559 TCTTATAGAATTATTGATGATGG + Intronic
1036500175 8:9307050-9307072 GCTTCTAAGATGAATGATCAAGG + Intergenic
1036639923 8:10576692-10576714 TCATTTAGAATTATTGATGATGG - Intergenic
1036877088 8:12482426-12482448 TCATTTAAAATTATTGGTGATGG + Intergenic
1038094907 8:24297548-24297570 GCATTTAAAAAGATTTATGTTGG + Intronic
1038787900 8:30637819-30637841 TTTTTTAAAATTATAGATGAAGG - Intronic
1039246177 8:35611098-35611120 GCTTTAAAAATGAAGGAAGAAGG - Intronic
1039246307 8:35612637-35612659 GCTTTAAAAATGAAAGAAGAAGG + Intronic
1040636042 8:49274265-49274287 GCTTTGAATATGAGGGATGAAGG + Intergenic
1040875830 8:52151033-52151055 AATTTTAAATTGATGGATGATGG - Intronic
1041127896 8:54663869-54663891 GATTTTAAAAAGATTAATCATGG + Intergenic
1041441856 8:57905527-57905549 TATTTTAAAATGATTGAGGTTGG + Intergenic
1041465982 8:58158023-58158045 ACTTATAAAATGTTAGATGATGG + Intronic
1041620913 8:59968105-59968127 GCATTAAAAATGATGGATGTTGG - Intergenic
1041794615 8:61733750-61733772 GCTTTAAAAATGTTTAATGGTGG - Intergenic
1042007929 8:64203368-64203390 GCTTTAAAAAATATTGATGGAGG + Intergenic
1042217806 8:66443889-66443911 GCTTTTACACTGATGGATGATGG - Intronic
1042450127 8:68935428-68935450 ACCTTTGAAATGTTTGATGAAGG + Intergenic
1042702587 8:71632556-71632578 GCTTCTAAAATGTTTGATGCTGG - Intergenic
1043405096 8:79922726-79922748 ACTTTTAAAATAATTGATTGAGG - Intronic
1043491998 8:80759159-80759181 GCTTTTAATGTGACTGATTAGGG + Intronic
1043521551 8:81051815-81051837 GTCTTTAAAATGATTTATGCAGG - Intronic
1043796258 8:84545163-84545185 GATTATAAAATAAGTGATGATGG - Intronic
1044300580 8:90578574-90578596 GCTTTTGAAATGAGAGTTGAGGG - Intergenic
1045551631 8:103178187-103178209 TCTTTTTAACTCATTGATGAGGG + Intronic
1046926940 8:119801726-119801748 GCTTTTAAAAAGATAGATATTGG - Intronic
1046988599 8:120421696-120421718 GATTGTAAAATGTTTGAGGAAGG - Intronic
1047109633 8:121774708-121774730 GTTAATAAAATGAATGATGATGG - Intergenic
1047742413 8:127817176-127817198 TCTTTTGAGATGATTGCTGAAGG - Intergenic
1048100901 8:131350540-131350562 GGTTCTGAAAAGATTGATGAAGG + Intergenic
1048745720 8:137612923-137612945 GCTTATAAAACAATTGATCAGGG - Intergenic
1048763805 8:137825269-137825291 TCATTTAGAATGATTGGTGATGG + Intergenic
1052126194 9:24777634-24777656 TCTTTTAAAACGATTCATGGAGG + Intergenic
1052329168 9:27249765-27249787 GGTTTTATCATAATTGATGAGGG + Intergenic
1052343792 9:27388249-27388271 GCGTCTAAAATGATTTATGTAGG + Intronic
1052610509 9:30767189-30767211 GCTTTTAAAATCCTCTATGAAGG - Intergenic
1052654087 9:31334002-31334024 TCGTATAGAATGATTGATGATGG - Intergenic
1055025691 9:71717990-71718012 GCTTTTAAAAATAATGATAATGG - Exonic
1055373091 9:75621454-75621476 TCTTTTAAAATTTTTGATGTGGG + Intergenic
1055975757 9:81953763-81953785 GTTTTTAAAATGACTGGTGATGG + Intergenic
1056099632 9:83288615-83288637 GCTGGTAAAATAATTGAAGATGG + Intronic
1056412196 9:86340890-86340912 GCTTTTAAAATTATTTATGTGGG - Intronic
1058790689 9:108442090-108442112 TTTTTTAAAATGTTTGTTGAAGG + Intergenic
1059106930 9:111520174-111520196 TTGTTTAAAATGATTTATGATGG - Intergenic
1059656601 9:116363218-116363240 GCCTTTCAAGTGCTTGATGAAGG - Intronic
1061000637 9:127900254-127900276 GCTGTTAAAATGAAGGATGCGGG + Intronic
1061251652 9:129429882-129429904 GCTATTAACATGTTTGATTATGG + Intergenic
1186112458 X:6272852-6272874 TCATTTAGAATGATTGGTGATGG + Intergenic
1186934680 X:14435306-14435328 GCTTCACAAATAATTGATGATGG - Intergenic
1188409377 X:29852225-29852247 CCTGTTCAAATGATTGATGCCGG - Intronic
1188450820 X:30307189-30307211 CCTTTCAAAATGATTGAAGTGGG - Intronic
1189990903 X:46593989-46594011 GTTTTTAAAATTATTTTTGATGG - Intronic
1190518596 X:51251975-51251997 GTTTTTAATATGATGGATAATGG + Intergenic
1190641751 X:52487010-52487032 TGTTTTAAGATGACTGATGATGG + Intergenic
1190645921 X:52525855-52525877 TGTTTTAAGATGACTGATGATGG - Intergenic
1193081907 X:77414468-77414490 GCTCTTAAAAGGAGGGATGAAGG - Intergenic
1194345863 X:92764876-92764898 GCTTTTTAAATTAGTGATGTTGG - Intergenic
1194529100 X:95022102-95022124 GGTTTGGAAATGATTGATAATGG - Intergenic
1195495984 X:105533916-105533938 GCTGTAAAAATGAATGAGGATGG - Intronic
1196073472 X:111548974-111548996 TCGTATAGAATGATTGATGATGG - Intergenic
1196533167 X:116813148-116813170 TCATATAGAATGATTGATGATGG + Intergenic
1196572883 X:117284195-117284217 TCGTATAGAATGATTGATGATGG - Intergenic
1197283881 X:124571881-124571903 TCTTATAAAATGATTCAAGATGG - Intronic
1197387473 X:125819037-125819059 CATTTTTAAATGATTAATGATGG + Intergenic
1197654595 X:129102906-129102928 GCTTATAAAATGATTCCTAAAGG - Intergenic
1198276642 X:135100297-135100319 GTTTTTAAAATGATGTTTGATGG + Intergenic
1198299435 X:135320623-135320645 CTTTTTAAAATGATGAATGATGG + Intronic
1198521553 X:137458496-137458518 GCTTTTAACAAAATTGAAGAAGG - Intergenic
1198889710 X:141380155-141380177 GCTTTTAACATGAGGGATGCTGG - Intergenic
1198925666 X:141791484-141791506 GCTTTGAAAATCATTGAAAATGG + Intergenic
1198945238 X:142004810-142004832 GCTGTTAATATTATTGAGGATGG + Intergenic
1200654211 Y:5881526-5881548 GCTTTTTAAATTAGTGATGTTGG - Intergenic
1201233556 Y:11889073-11889095 TCTTATAGAATGATTGATGATGG + Intergenic
1201344678 Y:12969271-12969293 GCTTTTAAAATGGGTTCTGATGG + Intergenic
1201540361 Y:15099444-15099466 TCATGTAGAATGATTGATGATGG + Intergenic
1201902646 Y:19059034-19059056 GCTTATAAACGGATTCATGAAGG + Intergenic
1201929362 Y:19324710-19324732 CCTCATAAAATGATTTATGAAGG + Intergenic
1202592342 Y:26499118-26499140 GCTTTTTAAAGGATAGATGAGGG + Intergenic