ID: 1113718027

View in Genome Browser
Species Human (GRCh38)
Location 13:112528030-112528052
Sequence GACCCCTGTGTGGCTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113718023_1113718027 7 Left 1113718023 13:112528000-112528022 CCAGCACCAGCCAGGTGGCACTG 0: 1
1: 0
2: 5
3: 52
4: 437
Right 1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 227
1113718025_1113718027 -3 Left 1113718025 13:112528010-112528032 CCAGGTGGCACTGTAGAAGTGAC 0: 1
1: 0
2: 2
3: 9
4: 113
Right 1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 227
1113718024_1113718027 1 Left 1113718024 13:112528006-112528028 CCAGCCAGGTGGCACTGTAGAAG 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 227
1113718020_1113718027 23 Left 1113718020 13:112527984-112528006 CCATGTGTACAAGGGGCCAGCAC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 227
1113718019_1113718027 24 Left 1113718019 13:112527983-112528005 CCCATGTGTACAAGGGGCCAGCA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113718027 Original CRISPR GACCCCTGTGTGGCTCCCCC AGG Intronic
900131242 1:1088225-1088247 GACCCCCGCATGCCTCCCCCAGG + Intronic
900169354 1:1258785-1258807 ACACCCTGTGTGGCTTCCCCTGG + Intronic
900213259 1:1467734-1467756 GACCCATGGGTGCCTCCCCTTGG + Intronic
900218485 1:1494844-1494866 GACCCATGGGTGCCTCCCCTTGG + Intronic
900503455 1:3017688-3017710 GACCCCTGTGGGTCTCACACGGG + Intergenic
901800541 1:11705567-11705589 GAACCCCGTGTGGCTGTCCCAGG - Intronic
902112991 1:14098755-14098777 CAACCCTGTGTGGCTGCCCTGGG + Intergenic
902368543 1:15992043-15992065 GATCCCTTTGTGGCCACCCCAGG - Intergenic
903765113 1:25729077-25729099 CACCCCTCTGTGGCTCCTCATGG + Intronic
904048136 1:27621717-27621739 CAGACCTGTGTGGCTCCACCTGG - Intronic
905220014 1:36439047-36439069 GACACCTGTGTGGTCCCCTCAGG - Intronic
905345696 1:37309607-37309629 GACCCTTCAGTGGCTCCCCTTGG + Intergenic
905649450 1:39646717-39646739 CGCCCCTGTGTGGCTCCTGCGGG - Intergenic
907785476 1:57607920-57607942 GACCCCTCTGTGGTTCTGCCTGG - Intronic
911963699 1:104338429-104338451 GTCTTCTGTGTGGCTCACCCTGG + Intergenic
914917995 1:151830159-151830181 GACCCCTCTCTGGCTTCCACGGG + Intronic
919976378 1:202615642-202615664 GGCCCCTGGCTGGCTCCCACAGG + Intronic
923546007 1:234923765-234923787 AACCCCTCAGTGGCTCTCCCTGG + Intergenic
1063090658 10:2863589-2863611 GCCCCCTGTGGGGTTCCCCATGG - Intergenic
1063211182 10:3882618-3882640 GACCCATGTAGGGCTCCCCAGGG + Intergenic
1063565038 10:7165112-7165134 GACCCCTCAGTGACTCCCTCTGG - Intronic
1063949861 10:11212324-11212346 GCTCCCTGTGAGGCCCCCCCGGG + Intronic
1064141321 10:12793057-12793079 GAGCCCTGTGTTACTCACCCTGG + Intronic
1066999003 10:42588637-42588659 GAACCCTTTGTGGCTCTGCCCGG - Intronic
1067069845 10:43123632-43123654 GACCAGTGAGTGGCTCCACCTGG - Intronic
1067107908 10:43377766-43377788 CACCTTTGTGTGGCTTCCCCTGG - Intergenic
1069897204 10:71687239-71687261 GACCCCTGCGTAGGTCCACCAGG - Intronic
1070961999 10:80505742-80505764 CACCACCGTGTGGCTTCCCCTGG + Intronic
1071298790 10:84241385-84241407 GGCCCTTGCGTGGCCCCCCCAGG - Exonic
1072800349 10:98388452-98388474 GACCCCACCCTGGCTCCCCCTGG - Exonic
1076391520 10:130106090-130106112 CAACCCTGCGTGGCTCCCCCAGG - Intergenic
1076485191 10:130811214-130811236 CACCTTCGTGTGGCTCCCCCGGG - Intergenic
1076637386 10:131891374-131891396 GCCCACTCTGTGACTCCCCCTGG + Intergenic
1076872119 10:133199305-133199327 GTCCCCTGTGGGGCTCTCCCTGG - Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077298176 11:1835655-1835677 GAACCCGCTGTGGCTCCCTCGGG - Intronic
1077497887 11:2895363-2895385 GATGCCAGTGTGGCTGCCCCCGG + Intronic
1080878926 11:36301262-36301284 GACCCTTCTGTGGCCCTCCCAGG - Intronic
1081372416 11:42320660-42320682 ATCCCTTGTGTGGCTCCCACCGG - Intergenic
1081874110 11:46397212-46397234 GCCCACAGTGTGGCTCTCCCGGG + Exonic
1084004232 11:66314778-66314800 CACCCCTGTGAGGCTGCCCCTGG + Exonic
1084953389 11:72678888-72678910 CACCCCTGGGTGACTCCCTCTGG + Intergenic
1084960300 11:72712960-72712982 GGCTCTGGTGTGGCTCCCCCAGG - Intronic
1085641825 11:78197587-78197609 GGCCTCTGTGTGGCTCCACTTGG + Intronic
1091715797 12:2775305-2775327 CAAGCCTCTGTGGCTCCCCCTGG - Intergenic
1092881527 12:12891185-12891207 GAGGCGGGTGTGGCTCCCCCGGG + Exonic
1093479026 12:19585403-19585425 TTCCCCTGTTTGGTTCCCCCAGG - Intronic
1101101384 12:101397353-101397375 GACCCCTGTGTTGCTCAGGCTGG - Intronic
1102896412 12:116601821-116601843 GACTCCTCTATGGCTCCCCAGGG - Intergenic
1102908215 12:116693761-116693783 GACCCCCGTGCGACTCCCACTGG - Intergenic
1104658707 12:130593166-130593188 GGCCCCGGTGTGGCTCCCCAAGG + Intronic
1106172159 13:27297488-27297510 GACCCCTGTGAGGCCCCCACTGG + Intergenic
1107038308 13:35923160-35923182 GACCCCTGGGTGGATCTCCCAGG + Intronic
1108267974 13:48731151-48731173 GAGACCTGTGTGTCTCCCACAGG - Intergenic
1108384948 13:49890635-49890657 CAACCCTGCGTGGCTCCTCCAGG - Intergenic
1109126867 13:58528659-58528681 TAACCCTGCGTGGCTCCTCCAGG - Intergenic
1110155611 13:72313234-72313256 GACCCCTGCGGGCCTCACCCTGG - Intergenic
1110410323 13:75197856-75197878 GGCCTCTGTGTTGCTCCTCCAGG - Intergenic
1111249929 13:85589464-85589486 GACCTCTGCATGGCTCCCCCAGG - Intergenic
1111924786 13:94451092-94451114 GACCCCTCTCTGGTTCCCCAGGG - Intronic
1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG + Intronic
1115172970 14:30529404-30529426 GTGCCCTGTATGGTTCCCCCTGG - Intergenic
1119261763 14:73241921-73241943 GACCCCTGAGTGGCTCCAGGTGG + Intronic
1119651483 14:76387076-76387098 GACCCTTGTGAGGGTCTCCCAGG + Intronic
1119774271 14:77238871-77238893 CACCCCGGGGTGGCTCTCCCTGG + Intronic
1120752324 14:88209475-88209497 GGCTCCTCTGGGGCTCCCCCAGG - Intronic
1121543996 14:94750442-94750464 CACAGCTGTGTGGCTCCCTCAGG - Intergenic
1121553962 14:94822445-94822467 AAGCCCTGTGAGGCTCCCCAAGG - Intergenic
1122265523 14:100544931-100544953 GTCAGCTGGGTGGCTCCCCCCGG + Intronic
1122267395 14:100553106-100553128 GACGCCTGTTTTCCTCCCCCAGG + Intronic
1122753020 14:103953288-103953310 GATGCCTGGGTGGCTCCCACAGG - Intronic
1124492025 15:30163992-30164014 GGCCCCTGGCTGGCTCCCACAGG + Intergenic
1124751512 15:32374325-32374347 GGCCCCTGGCTGGCTCCCACAGG - Intergenic
1124848959 15:33317407-33317429 GGACCCAGTGTGGCTCCCCAAGG - Intronic
1125241666 15:37583018-37583040 GCCCCCTGTGAGGCTGCCGCTGG - Intergenic
1125348423 15:38742749-38742771 GACCCCAGTGTGGTGCCCCATGG + Intergenic
1128053403 15:64682565-64682587 GACCAGTGTGGGGATCCCCCTGG - Exonic
1130648950 15:85751424-85751446 CACCCCTGTGGGTGTCCCCCCGG + Intergenic
1132330005 15:101005740-101005762 CACCCCAGTGGGGCTCCCCCTGG + Intronic
1133428102 16:5710853-5710875 CATCCCTTTCTGGCTCCCCCAGG - Intergenic
1139653292 16:68373255-68373277 GACCCACTTGTGGCTCCCACAGG - Intronic
1141592355 16:85077335-85077357 GACCCCTGCGGGGCTCCCTCTGG + Intronic
1141921572 16:87139111-87139133 GACCCCTGTCCACCTCCCCCAGG + Intronic
1141983860 16:87566830-87566852 GAGCCCTCTGTGGCACCCCGAGG - Intergenic
1142081423 16:88151073-88151095 GCCCCCTGTGGGGCTTCACCTGG - Intergenic
1142492924 17:290256-290278 GCCCGCTGTGTGGCTCTCCCTGG - Intronic
1142984968 17:3690188-3690210 CACCCCTGTGCCCCTCCCCCAGG + Intronic
1144947550 17:18977662-18977684 GACCCCAGGGTGGCTCCCCATGG - Exonic
1145166020 17:20614090-20614112 GACCCCTGGGTTGCGGCCCCTGG + Intergenic
1145309467 17:21693472-21693494 CACCCCTGCTTGGCTCCCCATGG + Intronic
1147056413 17:37838691-37838713 AACCCCTGTGTGGCTCTCCACGG + Intergenic
1148875000 17:50681868-50681890 GACCCCAGCCTGGCTTCCCCAGG + Intronic
1150623397 17:66824705-66824727 GGCCCCTCTGTGGCCCCCCCGGG - Intergenic
1152024375 17:77799099-77799121 TTCCCCTGTGTGGCTCTCCACGG - Intergenic
1152268000 17:79307305-79307327 GCCTCCTGGGTGGCTCCCACCGG - Intronic
1152318524 17:79594932-79594954 GCCCTCTGTGTGGCACCCACAGG - Intergenic
1153892719 18:9533049-9533071 GGCCCCTGTGAGGCCCCCACAGG - Intronic
1155325448 18:24660122-24660144 AAGCCCACTGTGGCTCCCCCGGG + Intergenic
1155381992 18:25233000-25233022 CACACCTGTGTATCTCCCCCAGG - Intronic
1158100122 18:53820964-53820986 GTCTTCTGTGTGGCTCACCCTGG - Intergenic
1158226351 18:55205520-55205542 GACCCCTGTTTCCCTCCACCTGG + Intergenic
1158772243 18:60533069-60533091 GACAGCTTTGTGTCTCCCCCAGG - Intergenic
1160090883 18:75825633-75825655 GACTCCTGTGTGTCTGCCCTGGG - Intergenic
1160236359 18:77089208-77089230 GACCCCTGTGTGGCCCTGGCTGG + Intronic
1161373992 19:3929488-3929510 GGCCCCTCTCTGGCTGCCCCAGG - Intergenic
1161431397 19:4234373-4234395 GTCCCCTCTGTGGCAGCCCCAGG + Intronic
1161772155 19:6236719-6236741 GACCCCTTCCTGGCTACCCCTGG + Intronic
1161982957 19:7639367-7639389 GAGCCCTGTGTGGGACTCCCAGG + Intronic
1163591012 19:18194132-18194154 GCCCCCTGTTTGGGTCGCCCTGG + Intronic
1163597050 19:18226341-18226363 GATCCCCGCGCGGCTCCCCCGGG - Intronic
1164931414 19:32178952-32178974 GACCCCTACGTGGCTCCCCAGGG + Intergenic
1166012263 19:39951231-39951253 GTCCCCAGTGTGGCTCCAACTGG - Intergenic
1166410789 19:42554394-42554416 GACTCCTGTCTGTGTCCCCCAGG - Intronic
1166824758 19:45601943-45601965 GCCCCCTCTGTTGCTCTCCCTGG - Intronic
1167661222 19:50797056-50797078 GAGGCCTGGGTGGCTCCCCCTGG + Intergenic
1168129349 19:54307605-54307627 GACCCCTGGATGTCTCCCCAGGG + Intronic
1168694658 19:58397466-58397488 GATCCGTGTGGGGCTGCCCCTGG - Intergenic
924996236 2:364475-364497 GACCTCTGTGAGGCTTTCCCAGG + Intergenic
925194712 2:1913697-1913719 GACCCCCGTGTGCCATCCCCAGG - Intronic
925867211 2:8238918-8238940 GTCCCCAGTGTGGCTGCACCGGG + Intergenic
928291098 2:30037958-30037980 ATCCCCAGTGTGGCTCCTCCTGG - Intergenic
932495543 2:72144213-72144235 GACCCGGGTGTGGCTCCCGCAGG - Exonic
934520051 2:95014360-95014382 GTCCCCTGTGTGGCCCTGCCTGG + Intergenic
934572704 2:95382745-95382767 GAGAGCTGTGTGGCTCCTCCAGG + Intronic
934916065 2:98302077-98302099 GACCCCAGTGTGGCCCCAGCCGG + Intronic
934992774 2:98933147-98933169 GTCCCCGCTGTGGCTCACCCTGG + Intronic
935976896 2:108587054-108587076 GAAGCCTGTGAGGTTCCCCCAGG + Intronic
937903815 2:127042004-127042026 GGCCCCTCTGTGGATCCCCAGGG + Intergenic
939112104 2:138020566-138020588 GAGCCCAGTGTGGCTCCAGCTGG + Intergenic
942218748 2:173748303-173748325 GGCCCCCGTGTGGCCCCCTCAGG - Intergenic
942491034 2:176490199-176490221 GACCTGTGTGTGCCTCCTCCAGG + Intergenic
945044694 2:205771561-205771583 GAAACCTGGGTGACTCCCCCAGG + Intronic
946249324 2:218403123-218403145 GACCCCTGTGGGGCTCACCTTGG - Exonic
946364432 2:219239951-219239973 GACTCAAGTGTGGCTCCCTCCGG - Exonic
946399449 2:219460887-219460909 CACCCCAGCGTGGCTCCCCAGGG - Intronic
948141008 2:235671394-235671416 GACACCTGTGGGGCCGCCCCAGG + Intronic
948488526 2:238296760-238296782 GACCACGGTGTGGCGGCCCCAGG + Intergenic
948496255 2:238351677-238351699 ACCACCTGTGTGGCTCCGCCAGG - Intronic
948588638 2:239036086-239036108 GACCCCTGGCTGCCTCCCCCTGG - Intergenic
948791367 2:240378851-240378873 GACTCCTGTGTGGCCACCACCGG - Intergenic
1171395225 20:24828867-24828889 GGCCCCTGTGTTGCTCACCATGG - Intergenic
1172843576 20:37916267-37916289 GACGCCTGTGTGCCTGCTCCCGG + Intronic
1173911651 20:46675114-46675136 GAGCCCAGTGTGGCTGACCCAGG + Intronic
1174060346 20:47828125-47828147 CACACCTGTTCGGCTCCCCCGGG + Intergenic
1174071552 20:47903244-47903266 CACACCTGTTCGGCTCCCCCGGG - Intergenic
1174152496 20:48495390-48495412 CACACCTGTTCGGCTCCCCCGGG + Intergenic
1174742157 20:53025573-53025595 CACCCCTGGGTGCCTGCCCCCGG + Intronic
1175092693 20:56518125-56518147 GACCTCTTTGTGGCTCCACACGG - Exonic
1175477732 20:59288718-59288740 GGCCCCTGTGTGGAACCCACAGG + Intergenic
1175928964 20:62484644-62484666 GAGCACGGAGTGGCTCCCCCAGG - Intergenic
1178358863 21:31931761-31931783 CAACCCTGAGCGGCTCCCCCAGG + Intronic
1178707774 21:34889244-34889266 GAGCGCGGAGTGGCTCCCCCGGG - Intronic
1179583065 21:42356948-42356970 CACCTCTGTGTGGCTCCACATGG + Intergenic
1179800821 21:43810824-43810846 GCCCTCTCTGTGCCTCCCCCAGG + Intergenic
1179833522 21:44012763-44012785 GACCCCTGGGGGGCGCCCTCGGG + Intronic
1181265485 22:21628626-21628648 TACCCCAGTGTGCCTCCCACCGG - Exonic
1181303783 22:21902434-21902456 GACCCCTGGGTGGTGCCCCAGGG - Intergenic
1181541299 22:23574554-23574576 GGCCCCCGTGTGGCCCTCCCAGG + Intronic
1181558583 22:23686459-23686481 GACCCTGGAGTGGCTGCCCCAGG + Intergenic
1181593248 22:23897176-23897198 AACCCCTGTTTGACTGCCCCAGG + Intronic
1181797084 22:25318768-25318790 GGGCCCTGTGTGGCCCTCCCAGG - Intergenic
1181813693 22:25421111-25421133 TGCCCCAGGGTGGCTCCCCCAGG + Intergenic
1182303040 22:29349435-29349457 GGCCCCTGTCTGGCTTCCCTGGG - Intronic
1183107631 22:35626236-35626258 AACCCTTCTGTGGCTCTCCCTGG - Intronic
1184186269 22:42867377-42867399 GACCCCTGAGTGGCCCAACCTGG - Intronic
1184724670 22:46336463-46336485 TTCACCTGTGTGGCTCCCCGCGG + Intronic
1185062459 22:48614141-48614163 GGCCCCTGTCTGGGGCCCCCAGG + Intronic
1185277677 22:49956837-49956859 GGACCCTTTGTGGCTCCCCTGGG - Intergenic
1185293421 22:50040502-50040524 GACCCCTGTGGGGGTTCTCCCGG + Intronic
1185332572 22:50258301-50258323 CAACCCTATGTGGCCCCCCCAGG - Exonic
950450925 3:13065052-13065074 AAGCCCTGTGTGTCTTCCCCAGG - Intronic
951090348 3:18565541-18565563 GACTCCTGTGTTGCTCCCCAGGG - Intergenic
952954732 3:38549832-38549854 GAATCCAGTGTGGCTCCCACAGG - Exonic
953929946 3:47000886-47000908 GACTCCTGGGTGGCTACCCCAGG + Intronic
954610997 3:51944498-51944520 GACCACTTTGTGTCTCACCCGGG + Exonic
954887765 3:53891663-53891685 GAGCCCGGTGCGGCTTCCCCGGG - Intronic
956870536 3:73412913-73412935 GACCCCCATGTGTCTCACCCTGG - Intronic
960449637 3:117790570-117790592 GACCCCTGTGTGGGTCTCACTGG + Intergenic
961691970 3:128676539-128676561 GGCCCGTGTGGGGCTCACCCTGG - Intronic
962175723 3:133152550-133152572 GACCCCTGTATATCTCCCCTGGG + Intronic
967935737 3:194726020-194726042 GACCCCTCAGCGGCTCCCCATGG + Intergenic
968495058 4:910749-910771 GACCCCTGCGTCTGTCCCCCAGG - Intronic
968669622 4:1842092-1842114 GATCCCTGGGTGGGTCTCCCAGG + Intronic
968869644 4:3235140-3235162 CTACCCTGAGTGGCTCCCCCAGG - Intronic
969529585 4:7723355-7723377 GGCCTCTGTGGGTCTCCCCCGGG + Intronic
976274447 4:83261786-83261808 GACCTCTCTGTGGCTCACTCGGG - Intronic
976803429 4:89019065-89019087 GACCTGTCTGTAGCTCCCCCAGG - Intronic
978861657 4:113457393-113457415 GACTCGTGTGTGGCACCGCCGGG - Exonic
981061297 4:140427739-140427761 GCTCCATGTGCGGCTCCCCCTGG - Exonic
982198539 4:152937821-152937843 GACCCCAGCGCGGCTCCCCGGGG + Intronic
986174151 5:5337547-5337569 GACCTGGCTGTGGCTCCCCCTGG - Intergenic
986523995 5:8653041-8653063 GACCTCTGTGGGGCTCCCTAGGG + Intergenic
986710407 5:10484509-10484531 GACCCCTGTGAAGCTCTCCCGGG - Intergenic
992105864 5:73448456-73448478 GCCCCCAGCGTGGCGCCCCCCGG - Intergenic
992503317 5:77362853-77362875 GCCCCCTCTGTGACTGCCCCCGG + Intronic
993680397 5:90870762-90870784 GCCCCTTGTGTGGCAGCCCCAGG - Intronic
999258504 5:150223047-150223069 GACCCGTGTCTGGCACCGCCGGG - Exonic
1001244258 5:170094171-170094193 GACCACTGTGGGCCTCCCCTGGG + Intergenic
1002100315 5:176854475-176854497 GAGCCCAGTGTGGCTCAGCCGGG - Intronic
1003182811 6:3806567-3806589 GTCCCCTGTGTGCCTTCCCAGGG - Intergenic
1003621929 6:7708121-7708143 GACACATGTCAGGCTCCCCCAGG - Intergenic
1007285872 6:40746942-40746964 GACCCCTGTGTTACTAGCCCTGG + Intergenic
1007407347 6:41642657-41642679 GTCCCCTCTGTGGCCCCTCCTGG + Intronic
1010035877 6:71324981-71325003 AAGCCCTCTGTGGCTTCCCCAGG + Intergenic
1011379517 6:86727508-86727530 CAACCCTCTGTGGCTCCCACTGG + Intergenic
1011394064 6:86887570-86887592 GGCCCCTGTTTACCTCCCCCAGG - Intergenic
1017048004 6:150365092-150365114 AGCCCCTGTGTGTATCCCCCTGG - Intergenic
1019047078 6:169157571-169157593 GAGGCCTCTGTGGCTCCCACTGG + Intergenic
1021585136 7:22199620-22199642 GAGCCCTTTGTGGCTCCCTGGGG - Intronic
1021962821 7:25889597-25889619 GCCCCCTGTGTGGAACCCCATGG + Intergenic
1025234590 7:57225905-57225927 CACACCTGTTCGGCTCCCCCGGG - Intergenic
1026241832 7:68582376-68582398 GACCATTGTGTGGCTCTCTCTGG + Intergenic
1026452365 7:70540477-70540499 GACGACTGTGTGCTTCCCCCGGG - Intronic
1027201399 7:76066067-76066089 GACCCCTGCCTGGCACCCTCTGG + Intronic
1033548916 7:142427390-142427412 GAACCCTGTGTGACCTCCCCGGG - Intergenic
1034273790 7:149815427-149815449 GGCCCCTGTGCCGCTGCCCCGGG + Intergenic
1034421504 7:150993391-150993413 CACCCCTGTGTGCCTTTCCCTGG - Intronic
1037269698 8:17113163-17113185 GATCCCTGTGGGGCTTTCCCTGG + Intronic
1037940729 8:22949033-22949055 GATCCCTGTGTGTCTCCCTTCGG + Intronic
1039404594 8:37301665-37301687 GATCCATGTGTGCCTCCCACTGG - Intergenic
1041720058 8:60967603-60967625 GAACCATGTGTGGCTGCCTCTGG + Intergenic
1041812583 8:61927892-61927914 TATCCCTGTGTGGCTGCCTCTGG + Intergenic
1044866748 8:96578681-96578703 GCCCCCTGTGTGACAGCCCCAGG + Intronic
1045260597 8:100570179-100570201 GACCAATGTGTAGCCCCCCCAGG + Intergenic
1045268845 8:100644554-100644576 GTCCCCAGTGAGGCTCCCTCGGG - Intronic
1048104166 8:131389238-131389260 GACATCTGTAAGGCTCCCCCAGG + Intergenic
1049306769 8:141908147-141908169 GCCGCTTGTGTGGCTCCTCCAGG - Intergenic
1051641680 9:19230282-19230304 GACCCCTGTGCGACCCCCGCGGG - Intergenic
1056599761 9:88037580-88037602 TACCTCTGTGTCACTCCCCCAGG + Intergenic
1057805784 9:98218858-98218880 GACCCCTGTGCTGCTCTACCGGG + Intronic
1059344101 9:113616631-113616653 GAGCCCTGTCTGTCTGCCCCTGG + Intergenic
1059656839 9:116365240-116365262 TCCCCCTGCGTGCCTCCCCCAGG + Intronic
1060054727 9:120403704-120403726 GACCCCTGTGTGGCTACACCAGG + Intronic
1060209125 9:121699544-121699566 CACCGCCGTGTGGCTCGCCCCGG - Intronic
1060404145 9:123364796-123364818 GACAGCTGAGTGGCTCTCCCAGG - Intronic
1060431548 9:123555181-123555203 GAGCCCCGGGTGGCTCCACCAGG - Intronic
1060735058 9:126061521-126061543 AACCCCTGGGGGGCTCCCCGGGG - Intergenic
1060788445 9:126468775-126468797 GACCCTTTGGTGGCTCCCCAGGG + Intronic
1061791796 9:133063023-133063045 GTCCCCTGTGTGACTCCTGCTGG - Intronic
1061795471 9:133083589-133083611 GTCCCCTGTGTGACTCCTGCTGG - Intronic
1061882269 9:133574323-133574345 GCCCCCTGTGTGCCAGCCCCTGG - Intronic
1061922527 9:133789785-133789807 GACCCCTGTGTGGTTCGCTGAGG + Intronic
1062026892 9:134344650-134344672 GCGCCCTCTGTGGCTCCCCAGGG + Intronic
1062118164 9:134820276-134820298 GTCCCCTGGGTGCCTGCCCCAGG - Intronic
1186704192 X:12124804-12124826 TACACCTGTGTGGCTCACCATGG + Intergenic
1189160496 X:38804551-38804573 GGCGCCTGGGTGGCTCCCCGCGG - Intronic
1193883778 X:86960229-86960251 GTGCCCTGTGTGGCTGCCCAGGG + Intergenic
1194342535 X:92722313-92722335 GACCCATTTGTAGCTCCCTCAGG - Intergenic
1198800176 X:140439897-140439919 GACCCCTGTATGCCCCCCTCCGG - Intergenic
1200078670 X:153564899-153564921 CACTTCCGTGTGGCTCCCCCAGG + Exonic
1200650898 Y:5839002-5839024 GACCCATTTGTAGCTCCCTCAGG - Intergenic