ID: 1113719812

View in Genome Browser
Species Human (GRCh38)
Location 13:112546691-112546713
Sequence TCTGTGTCCAGCGGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113719812_1113719826 29 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719826 13:112546743-112546765 TCCGGAGAGGTGCTGGGAACTGG 0: 1
1: 0
2: 3
3: 19
4: 201
1113719812_1113719819 -2 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719819 13:112546712-112546734 GAAAGTGACAGAGGAGTTTGGGG 0: 1
1: 0
2: 3
3: 33
4: 423
1113719812_1113719817 -4 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719817 13:112546710-112546732 CAGAAAGTGACAGAGGAGTTTGG 0: 1
1: 0
2: 0
3: 45
4: 399
1113719812_1113719820 -1 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719820 13:112546713-112546735 AAAGTGACAGAGGAGTTTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 348
1113719812_1113719818 -3 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719818 13:112546711-112546733 AGAAAGTGACAGAGGAGTTTGGG 0: 1
1: 0
2: 4
3: 35
4: 447
1113719812_1113719821 11 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719821 13:112546725-112546747 GAGTTTGGGGGATCCAGTTCCGG 0: 1
1: 0
2: 1
3: 8
4: 125
1113719812_1113719824 23 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719824 13:112546737-112546759 TCCAGTTCCGGAGAGGTGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1113719812_1113719823 22 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719823 13:112546736-112546758 ATCCAGTTCCGGAGAGGTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
1113719812_1113719822 16 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719822 13:112546730-112546752 TGGGGGATCCAGTTCCGGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113719812 Original CRISPR TCTGTGTCCAGCGGGCCCCT GGG (reversed) Intronic
900428045 1:2589369-2589391 CCAGTGTCCAGCGGCCCCATGGG + Intronic
901153593 1:7121055-7121077 TTTGTGGCCACCAGGCCCCTAGG - Intronic
901221399 1:7585929-7585951 TCTGTGTCCCCCAGGACCCTGGG + Intronic
901955906 1:12785437-12785459 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
901978328 1:13012935-13012957 TCTGTCTCCTGCCTGCCCCTGGG - Intronic
901979279 1:13021485-13021507 TCTGTCTCCTGCCTGCCCCTGGG - Intronic
902002803 1:13207453-13207475 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
902003756 1:13216003-13216025 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
902022033 1:13353217-13353239 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
902022981 1:13361747-13361769 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
903541424 1:24098546-24098568 TCTGTCACCAGGGTGCCCCTGGG - Intronic
905943490 1:41883068-41883090 TGTGTGACCAGGGGACCCCTTGG - Intronic
906402322 1:45513995-45514017 TCTGTCTCCAGCCAGTCCCTGGG + Intronic
907120844 1:52006735-52006757 TCTGTCTCCTGCCGGTCCCTGGG + Intergenic
907364231 1:53946175-53946197 CCTGGGTCCTGCGGGCCCCGGGG - Exonic
908646819 1:66287473-66287495 TCTGAGTCCAGCGTTCCTCTTGG + Intronic
911595443 1:99794044-99794066 TCTGTCTCCTGCATGCCCCTGGG - Intergenic
911947826 1:104135201-104135223 TCTGTCTCCAGCTCGTCCCTGGG - Intergenic
912642417 1:111360178-111360200 TCTGTCTCCAGCTCGTCCCTGGG - Intergenic
914924548 1:151872990-151873012 TCTGTCTCCTGCATGCCCCTGGG + Intergenic
917971581 1:180211414-180211436 CCTGTGGGCAGCGGGCCACTGGG + Intergenic
918514062 1:185343078-185343100 TCCGTCTCCAGAGGGCTCCTGGG - Intergenic
921821173 1:219619063-219619085 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
924260749 1:242228381-242228403 TCTGTGTCCTGCGGGTGCCTCGG - Intronic
924953639 1:248907394-248907416 ACTGTGTCCTGCCTGCCCCTGGG - Intronic
1064278994 10:13933765-13933787 TCTGTGTCCCAGGGGCCTCTAGG - Intronic
1064301126 10:14123806-14123828 TTTGTTTCCAGCGGGCTCCGTGG + Intronic
1070161422 10:73868844-73868866 TCTGGGTCCAGCTGGCCCTGGGG - Intronic
1070665327 10:78338586-78338608 TCTCTCTCCATCTGGCCCCTGGG + Intergenic
1070870257 10:79745080-79745102 TCTGTCTCCTGCATGCCCCTGGG + Intergenic
1071637177 10:87267300-87267322 TCTGTCTCCTGCATGCCCCTGGG + Intergenic
1071658068 10:87470654-87470676 TCTGTCTCCTGCATGCCCCTGGG - Intergenic
1071974316 10:90939872-90939894 CCTGTGTCCAGTGGTCCCGTGGG - Intergenic
1072155823 10:92722904-92722926 TTGGTGTCCAGCTGGGCCCTGGG - Intergenic
1072999399 10:100275828-100275850 TCTGGTTCCAGAGGGCACCTGGG - Intronic
1075298610 10:121300104-121300126 TCCATGCCCAGCGGGCCCTTAGG - Intergenic
1075655747 10:124160022-124160044 TCTGTGTCCAGCAGGCTTCTTGG - Intergenic
1075890032 10:125940567-125940589 TCTGTCTCCTGCGTGCCCCTGGG - Intronic
1076853428 10:133103968-133103990 TCTGTGGCCAGCGGTCCCAGGGG + Intronic
1077141923 11:1028524-1028546 TCTGTGTCCGGGGAGCCCCCAGG - Intronic
1078216898 11:9319214-9319236 TCTGTCTCCTGCTGGTCCCTGGG - Intergenic
1078570335 11:12452489-12452511 TCTGTGTCCAGTGTGGCCTTGGG + Intronic
1081770856 11:45649924-45649946 TCTGGATCCAGCGGGCCACGTGG + Exonic
1082716356 11:56618808-56618830 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1083388065 11:62327085-62327107 TCTGTCTCCAGCTCGTCCCTGGG + Intergenic
1084182280 11:67452733-67452755 TCCGTGTCCAGCAGGACTCTGGG - Intronic
1084424953 11:69079509-69079531 GCTGTAGCCAGCAGGCCCCTCGG + Intronic
1084742275 11:71147394-71147416 CCAGTGTCCACCGTGCCCCTGGG - Intronic
1089654207 11:119935272-119935294 TCTGTCTCCAGCTGGCCCAAAGG + Intergenic
1090453047 11:126823452-126823474 TCTGTGTCCTGGGAGACCCTGGG + Intronic
1092767817 12:11869427-11869449 ACTGTGTCCAGAGGACCCCCAGG + Exonic
1093768952 12:22997910-22997932 TCTGCCTCCAGCTGGTCCCTGGG + Intergenic
1098838073 12:75445313-75445335 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
1101780031 12:107826910-107826932 TCTGTCTCCTGCTGGTCCCTAGG - Intergenic
1102006477 12:109592300-109592322 ACTGTGTCCAGGGGGAGCCTGGG - Intronic
1102448705 12:113024322-113024344 TCTGTGTGTACCGGACCCCTAGG + Intergenic
1104418096 12:128612204-128612226 TCTGTGTCCACCTGGACCCTGGG - Intronic
1104735773 12:131135321-131135343 CCTGTGTCAAGAGGGCCCATGGG + Intronic
1105280208 13:18958901-18958923 TCTGTGTCAGGCTGGCCCCCAGG + Intergenic
1107718421 13:43223304-43223326 TCTGTGTCCACCCCGCTCCTGGG + Intronic
1108519530 13:51233955-51233977 TCTGTGTCCAGCAGGGTCCTGGG + Intronic
1113719812 13:112546691-112546713 TCTGTGTCCAGCGGGCCCCTGGG - Intronic
1113767583 13:112890730-112890752 TCTGTGTCCAGCCAGCCCCATGG - Intergenic
1114438126 14:22725139-22725161 TCTGTCTCCTGCTGGTCCCTGGG - Intergenic
1117189212 14:53274579-53274601 TGTGAGTACAGCGGGCCCCCTGG - Intergenic
1121435242 14:93914927-93914949 TCTGTGTAGGGCTGGCCCCTAGG + Intergenic
1121664285 14:95660161-95660183 CCTGTGTCCAGAGGAACCCTGGG - Intergenic
1121933300 14:97993204-97993226 GCTGGGTCCAGCAGGCACCTTGG - Intergenic
1122389286 14:101369336-101369358 TCTCTGGCCAGCTGGCCACTTGG - Intergenic
1122883146 14:104699105-104699127 TCTGTGTCCAGGGACACCCTGGG + Intronic
1122997625 14:105273964-105273986 TCTGTCTCCTGCCTGCCCCTGGG + Intronic
1123077455 14:105675696-105675718 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
1124119256 15:26875189-26875211 TCTGTGTCCAGGAGACTCCTGGG + Intronic
1124416249 15:29475219-29475241 TCTGTCTCCAGCTCACCCCTTGG - Intronic
1128127186 15:65201840-65201862 TCTGGGTCCCTGGGGCCCCTGGG - Intronic
1130683225 15:86014477-86014499 TCTGTGTCCTGCGGGCTGCCTGG + Intergenic
1130821691 15:87502845-87502867 TCTGTGTCCAAAGGGCCCAGGGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132622799 16:875715-875737 TGTGTGTCCAGGGGTGCCCTTGG + Intronic
1135668419 16:24354783-24354805 CCTGTGCCCAGCCAGCCCCTGGG - Intronic
1136355233 16:29740728-29740750 TCTGTGTCCTGCTCGTCCCTGGG + Intergenic
1137618310 16:49859185-49859207 TCAGTCTTCAGCAGGCCCCTAGG - Intergenic
1138413969 16:56860674-56860696 GCTGAGTGCAGTGGGCCCCTCGG - Intergenic
1139439125 16:66955865-66955887 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1141416513 16:83879674-83879696 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1142006662 16:87692545-87692567 TCTGTGGCCAGTGGGACCCAGGG - Intronic
1142957391 17:3531179-3531201 TCTGTGTCCAGCCTGCACTTTGG - Intronic
1143918999 17:10315859-10315881 TCTGGGTCCAGCCGGGCCATGGG - Intronic
1144874925 17:18392515-18392537 TGTGTGTCCAGTGGGTCCCACGG - Intergenic
1145057905 17:19715153-19715175 ACTGTGTTCTGCGGGCACCTGGG - Exonic
1145157300 17:20551906-20551928 TGTGTGTCCAGTGGGTCCCACGG + Intergenic
1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG + Intronic
1148865044 17:50624025-50624047 CCTGTGTCCCAGGGGCCCCTCGG - Exonic
1150706421 17:67491263-67491285 TCAGTGTCCTGCGGGTTCCTGGG - Intronic
1151550942 17:74822203-74822225 TCTGTGGCCAGCAGGGCCCCGGG + Intronic
1152095504 17:78269596-78269618 TCTGTGCCAAGGGGGCCCCTAGG - Intergenic
1152229175 17:79106126-79106148 CCTGTGTCCCCCGGGCCCCCAGG - Intronic
1152248835 17:79200907-79200929 TCTGTGTGCGGCGGGCAGCTGGG + Intronic
1154016820 18:10626369-10626391 TCTGGGTCCAGTGGAGCCCTCGG + Intergenic
1154159820 18:11972705-11972727 CTTCTGTCCAGGGGGCCCCTGGG - Intergenic
1154188694 18:12209298-12209320 TCTGGGTCCAGTGGAGCCCTTGG - Intergenic
1154351727 18:13589347-13589369 TCTGTGTACATGGGGCCCCATGG + Intronic
1155942240 18:31810990-31811012 TCTGTCTCCTGCTTGCCCCTGGG + Intergenic
1155984771 18:32218525-32218547 CCTGTTTCCAGTGGGTCCCTTGG + Intronic
1156252542 18:35364884-35364906 TCTGTGCCCAGTGGGAACCTTGG - Intergenic
1158412731 18:57222094-57222116 TCTGTGTCCCCAGGCCCCCTAGG + Intergenic
1158721858 18:59932096-59932118 CCTGTGTCCTGAGGGCCCCTGGG - Intergenic
1159091369 18:63852821-63852843 TCTGTCTCCTGCATGCCCCTAGG + Intergenic
1160514462 18:79470815-79470837 TCTGAGTGCAGGGGGCCCCCGGG + Intronic
1160858409 19:1227523-1227545 TCCGCCTCCCGCGGGCCCCTGGG - Intronic
1160860698 19:1236279-1236301 GCTCTGCCCAGCGGGCCCCGGGG + Intronic
1161687819 19:5712088-5712110 TCTGGGCTCAGCGGGACCCTTGG - Intronic
1162005806 19:7778204-7778226 GCTGTGTCCAGCTGCCCCATAGG + Intergenic
1163323834 19:16590297-16590319 TCTGTGGCCAGCTGGCACCCTGG - Intronic
1163628207 19:18402956-18402978 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
1165574176 19:36800049-36800071 TCTGTCTCCTGCTGGTCCCTGGG + Intergenic
1165943640 19:39428456-39428478 GCTGTGTCCCGGGGGCCCCGTGG + Intergenic
1166557728 19:43712639-43712661 CCTGTGTCCAGCAAGCCCGTTGG - Intergenic
1166862456 19:45818176-45818198 TCTCTGCCCAGCTGCCCCCTGGG + Intronic
1167347106 19:48953361-48953383 TCTATGTCCAGAAGGCCGCTGGG - Intergenic
1168003725 19:53468815-53468837 TCTGTCTCCTGCTGGTCCCTGGG - Intronic
1168358539 19:55718382-55718404 TCTGTCTCCTGCTGGTCCCTGGG + Intronic
925142676 2:1560753-1560775 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
925459121 2:4044610-4044632 TCTATGTGCAGCGGGGCCCCGGG - Intergenic
925814524 2:7734537-7734559 TCTGTGTCAAGGTGGCCCATGGG - Intergenic
926210947 2:10868954-10868976 CCTGTGTCCCGCAGGCCCCTAGG - Intergenic
928201664 2:29251225-29251247 TGTGGGGCCAGCGGGCCCCATGG - Exonic
928455856 2:31420982-31421004 TCTGTGTCCAGAAGGCCTCAGGG - Intergenic
929778043 2:44940760-44940782 TCTGGGTCCAGAGGGCTCTTGGG + Intergenic
930524649 2:52512664-52512686 TCTGTGTCGAGAGGCCCACTTGG + Intergenic
934123848 2:88866986-88867008 TCTGTCTCCTGCATGCCCCTGGG - Intergenic
934514512 2:94977805-94977827 TCTGTGCCCATGGGACCCCTGGG + Intergenic
938421193 2:131148147-131148169 CCTGTGTCCTGAGGGTCCCTGGG - Intronic
944299154 2:198102781-198102803 TCTGTGTCCAGCTAGCACCAAGG + Intronic
944551007 2:200844753-200844775 TCTGTAGCCAGCAGCCCCCTGGG - Intergenic
946241136 2:218356839-218356861 TCTGTGTCCAGCTGTCTCCATGG - Exonic
947576185 2:231276631-231276653 GCTGTCTGCAGCGGGCGCCTGGG - Exonic
947913358 2:233816986-233817008 TCTGTCCCCAGAGGGCCCCTTGG + Intronic
1170746845 20:19107189-19107211 TCTGGGGCCAGAGGGCCCCCAGG + Intergenic
1171256798 20:23694815-23694837 TCTGTCTCCTGCTGGTCCCTAGG - Intergenic
1171303344 20:24083406-24083428 TCTGTGTCCAGAGGTGACCTTGG + Intergenic
1171495312 20:25550819-25550841 TCTGTCTCCTGCTGGTCCCTGGG - Intronic
1171495796 20:25554242-25554264 TCTGTGTGCAGGGGACCCATGGG + Intronic
1172413395 20:34743065-34743087 TCGGGGTTCAGGGGGCCCCTTGG + Exonic
1174189080 20:48727517-48727539 CATGTGTCCAGCAGGCCTCTAGG + Intronic
1175057594 20:56212271-56212293 TCTGTCTCCTGCATGCCCCTGGG - Intergenic
1175417854 20:58813284-58813306 TCAGTGTCCAGGAGGCACCTGGG - Intergenic
1176382187 21:6119084-6119106 GCTGTGTCCAGCAGGCTGCTTGG - Exonic
1179663429 21:42893073-42893095 CCTGTGCCCTGCGGGCGCCTGGG - Intronic
1179741285 21:43419155-43419177 GCTGTGTCCAGCAGGCTGCTTGG + Exonic
1179959254 21:44759059-44759081 ACTGTCGCCAGCTGGCCCCTGGG + Intergenic
1180964445 22:19779058-19779080 TCTGTGTCCTGTGGGCGGCTCGG + Intronic
1181003386 22:19998386-19998408 CCTGTGGCCAAAGGGCCCCTGGG + Intronic
1181802013 22:25353977-25353999 TCTGTGTCCGGCTGGGGCCTGGG - Intronic
1183351541 22:37337381-37337403 TCTGAGTCCTCAGGGCCCCTTGG + Intergenic
1183387878 22:37525446-37525468 GCTGTGTCCTGTGGCCCCCTGGG - Intergenic
1184241681 22:43214356-43214378 TCTGTGTCCTTGGGGCCCCAGGG - Intronic
1184475660 22:44719979-44720001 TCTGTGGCCTGCTAGCCCCTAGG + Intronic
1184707626 22:46225174-46225196 TCTGTGTCCATCTGGACACTGGG + Intronic
1184789016 22:46687768-46687790 ACTGTGGCCACCGAGCCCCTGGG - Intronic
952999571 3:38920275-38920297 TCTGTGTCCAGCTTCCCCCAGGG - Intronic
954389224 3:50260210-50260232 TTTGTGTCCAGCGGCCTCCGCGG - Intergenic
954535551 3:51356940-51356962 TCTGTGTGCTGTGTGCCCCTAGG + Exonic
955050684 3:55407762-55407784 TCTGTGGCCAGCTTGCCACTAGG + Intergenic
958761673 3:98316622-98316644 TCTGTCTCCTGCATGCCCCTGGG - Intergenic
962403328 3:135079925-135079947 TCTGTGTCCAGCGGGGTACCTGG + Intronic
964894929 3:161584257-161584279 TCTGTGTCCTGCTGACACCTCGG - Intergenic
968396290 4:241686-241708 TCTGTCTCCTGCATGCCCCTGGG + Intergenic
968428209 4:536845-536867 TCCGTCTCCAGCTGGCCACTGGG - Intronic
968503770 4:962777-962799 TCTGTGGCCATCCTGCCCCTGGG - Exonic
968644478 4:1732726-1732748 TCTGTGTCCGGCGTCTCCCTCGG + Intronic
968921531 4:3524575-3524597 GCTGTGCCCAATGGGCCCCTTGG + Intronic
971720046 4:30233374-30233396 ACTGTCTCCTGCGTGCCCCTGGG - Intergenic
972718879 4:41675819-41675841 TTTGTGTCATGCGGGCCCCAGGG + Intronic
980212392 4:129806517-129806539 TCTGTCCCCAGAGGGCCTCTTGG - Intergenic
985633980 5:1027089-1027111 GCTGTGCCCAGGGGGCCCCCAGG - Intronic
986126513 5:4887036-4887058 TCTCAGGCCATCGGGCCCCTTGG - Intergenic
986329168 5:6704855-6704877 TCTGTGTCCAACTGTCTCCTGGG + Intergenic
988265391 5:28942409-28942431 TCTGAGTCCAGCGGAGCACTAGG + Intergenic
988796507 5:34657029-34657051 TCTGACTCCAGGGAGCCCCTCGG + Intronic
991399933 5:66241512-66241534 TCTGAGTTCTGCGGCCCCCTTGG + Intergenic
992459335 5:76945438-76945460 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
992957368 5:81923697-81923719 TCTTTGTCCAACAGACCCCTTGG + Intergenic
994534309 5:101008318-101008340 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
995606366 5:113860049-113860071 TTTGTGCCCAGCGGACCCGTGGG + Intergenic
1000375458 5:160576811-160576833 TCTGGGTCCTGCTGGCCCCCTGG - Intronic
1003429063 6:6022412-6022434 TCTGTGGCCAGAGGTCCACTGGG + Intergenic
1003645668 6:7911067-7911089 TCTGAGCAGAGCGGGCCCCTGGG - Intronic
1004148151 6:13089296-13089318 TCTGTGTACTGAGGACCCCTGGG - Intronic
1005430240 6:25748973-25748995 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1006580915 6:35077492-35077514 TCTGTGCCCAGCGGGGCTCTGGG + Intronic
1007572474 6:42903120-42903142 TCTGTCTCCTGCATGCCCCTGGG - Intergenic
1012369806 6:98489884-98489906 TCTGTGTCCAGCACCTCCCTGGG + Intergenic
1014396660 6:120931946-120931968 TCTGTCTCCTGCTGGTCCCTGGG + Intergenic
1015394762 6:132721264-132721286 TCTGTCTCCTGCATGCCCCTGGG - Intergenic
1016940878 6:149482058-149482080 GCTGTGCCCCGAGGGCCCCTAGG - Intronic
1018366822 6:163129586-163129608 TCTGTGTCCAGTGGCCGCCCAGG + Intronic
1019157697 6:170050212-170050234 TCTGTGTTAAGCGGCCTCCTGGG - Intergenic
1019624945 7:2011274-2011296 TCTGTGCACAGGGAGCCCCTGGG - Intronic
1023015906 7:35968594-35968616 TCTGTGTCCAGCGGCCTCCCAGG - Intergenic
1025932249 7:66005168-66005190 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1026905546 7:74060813-74060835 TCTGTGGCCAGGGGACCACTAGG + Intronic
1027048549 7:75007253-75007275 TCTGTGTCCAGGTGGCCCTTGGG - Intronic
1027562623 7:79751309-79751331 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1031230599 7:119100699-119100721 TCTGTCTCCTGCTGGTCCCTGGG - Intergenic
1034474651 7:151275476-151275498 TCTTTGTCCCGCAGGACCCTGGG - Intronic
1035470878 7:159107807-159107829 TCTGTGCCAGGCGGGACCCTGGG - Intronic
1035566985 8:647835-647857 TCAGAGTCCAGCTGGCCCCGTGG - Intronic
1035579600 8:731613-731635 CCTGTGTCCGGCGGGTGCCTGGG - Intronic
1035579726 8:731995-732017 CCTGTGTCCAGCAGGTGCCTGGG - Intronic
1036224529 8:6946312-6946334 TCTCTGTCCACCTGGCCCATGGG + Intergenic
1040915435 8:52563737-52563759 TCTCAGTCCAGCCGGCCACTGGG - Intronic
1044619544 8:94175621-94175643 AGTGTGTCCAGCAGGCACCTAGG - Intronic
1049061264 8:140277933-140277955 TCTGTGTTGAGGGAGCCCCTGGG + Intronic
1049204598 8:141357893-141357915 TGTGTCTCCAGCGGGGCCCTCGG - Exonic
1052676564 9:31633333-31633355 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1053484106 9:38439253-38439275 CCTGTCTCCAGCTGGCCCCTTGG + Intergenic
1054812783 9:69447890-69447912 ACTGTGTCCACGGGGCCCCTGGG + Intronic
1056567299 9:87785420-87785442 TCTGTGTCCTGCCCGTCCCTGGG - Intergenic
1057217062 9:93234965-93234987 TGTGAGTCCACCTGGCCCCTTGG + Exonic
1059336583 9:113572818-113572840 TCTGTGCTCAGCCTGCCCCTAGG - Intronic
1060224971 9:121784991-121785013 TCGGTGACCAGGGGGCCCCGGGG - Exonic
1061209913 9:129185171-129185193 CCTGTGTCCACCCAGCCCCTTGG + Intergenic
1062105478 9:134752729-134752751 TCTGTGTCCACAGGACCCCAGGG - Intronic
1062346129 9:136116112-136116134 TCTGTGTCCAGGGGCCTCCCAGG + Exonic
1062558913 9:137130347-137130369 TGTGGGTCCAGCCGGCCGCTTGG - Intergenic
1187403146 X:18980341-18980363 TCTGTCTCCTGCCTGCCCCTGGG + Intronic
1188007187 X:25023196-25023218 TGTGCGTCCTGGGGGCCCCTCGG - Intergenic
1189212510 X:39295796-39295818 CCTGTGTCCACCAGGCCCCCAGG - Intergenic
1190194975 X:48309083-48309105 CCTGTCTCCAGCCGGCTCCTGGG - Intergenic
1190325889 X:49206677-49206699 TCTCTGTCCTGCAGGCCCGTGGG + Intronic
1191797307 X:65034896-65034918 TCTGTGGCCAGGGGGGCCCAGGG + Intergenic
1197839138 X:130726894-130726916 TCTTTCTCAAGAGGGCCCCTGGG + Intronic
1200142511 X:153909121-153909143 TCTGTGTCCAGAGGGTCCCATGG + Exonic
1200257153 X:154589135-154589157 TCTGTCTCCTGCCTGCCCCTGGG + Intergenic
1200259930 X:154608906-154608928 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic
1200260616 X:154615267-154615289 TCTGTCTCCTGCCTGCCCCTGGG - Intergenic