ID: 1113719812

View in Genome Browser
Species Human (GRCh38)
Location 13:112546691-112546713
Sequence TCTGTGTCCAGCGGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113719812_1113719822 16 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719822 13:112546730-112546752 TGGGGGATCCAGTTCCGGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 80
1113719812_1113719819 -2 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719819 13:112546712-112546734 GAAAGTGACAGAGGAGTTTGGGG 0: 1
1: 0
2: 3
3: 33
4: 423
1113719812_1113719824 23 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719824 13:112546737-112546759 TCCAGTTCCGGAGAGGTGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1113719812_1113719821 11 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719821 13:112546725-112546747 GAGTTTGGGGGATCCAGTTCCGG 0: 1
1: 0
2: 1
3: 8
4: 125
1113719812_1113719817 -4 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719817 13:112546710-112546732 CAGAAAGTGACAGAGGAGTTTGG 0: 1
1: 0
2: 0
3: 45
4: 399
1113719812_1113719826 29 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719826 13:112546743-112546765 TCCGGAGAGGTGCTGGGAACTGG 0: 1
1: 0
2: 3
3: 19
4: 201
1113719812_1113719823 22 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719823 13:112546736-112546758 ATCCAGTTCCGGAGAGGTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
1113719812_1113719818 -3 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719818 13:112546711-112546733 AGAAAGTGACAGAGGAGTTTGGG 0: 1
1: 0
2: 4
3: 35
4: 447
1113719812_1113719820 -1 Left 1113719812 13:112546691-112546713 CCCAGGGGCCCGCTGGACACAGA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1113719820 13:112546713-112546735 AAAGTGACAGAGGAGTTTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113719812 Original CRISPR TCTGTGTCCAGCGGGCCCCT GGG (reversed) Intronic