ID: 1113721285

View in Genome Browser
Species Human (GRCh38)
Location 13:112559549-112559571
Sequence CAGTGCCACCCATCCGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113721285 Original CRISPR CAGTGCCACCCATCCGAAGG CGG Intronic
914323088 1:146584247-146584269 CAGGGCCACCCATCCTCAGGAGG + Intergenic
921358531 1:214308686-214308708 CAGTGCCACACAGCAGATGGTGG + Intronic
1067175473 10:43943007-43943029 AAGTGCCACCCAACAGAGGGTGG + Intergenic
1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG + Intronic
1070788252 10:79174828-79174850 CAGTTTCTCCCATCCAAAGGGGG - Intronic
1072757436 10:98030412-98030434 CGGTGCCCCCCACCCTAAGGCGG - Intronic
1073615205 10:104988003-104988025 CAGTGCCACACATGGGAAGGTGG - Intronic
1074686300 10:115965234-115965256 CTCTGCCACCCATCCTATGGCGG - Intergenic
1075678320 10:124313330-124313352 CAATCCCACCCTTCCAAAGGAGG - Intergenic
1081546178 11:44073546-44073568 CATTGCCACACATCCCCAGGGGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1094278974 12:28713557-28713579 CAGTGCCACCCATCTGTACTGGG - Intergenic
1101575953 12:105996312-105996334 CAGTACCACCCAGCCAAAGAAGG + Intergenic
1104489606 12:129182611-129182633 AAGTCCCACCCATCTGATGGAGG + Intronic
1113721285 13:112559549-112559571 CAGTGCCACCCATCCGAAGGCGG + Intronic
1117097902 14:52315746-52315768 CAGTGACAGCCATCCTAAGGTGG - Intronic
1119653680 14:76401315-76401337 CAGTGTCACCCAGCTGATGGTGG + Intronic
1128311573 15:66634282-66634304 CAGGGCCACCCATTTGTAGGCGG + Intronic
1132196205 15:99916400-99916422 CAGTGCCACCCATCACAGTGAGG - Intergenic
1136655442 16:31706544-31706566 CAGTACCACCCATTCGAGAGGGG + Intergenic
1139534162 16:67561662-67561684 CAGTCCCACCCCTCCCCAGGAGG - Intergenic
1140010471 16:71126603-71126625 CAGGGCCACCCATCCTCAGGAGG - Intronic
1144711542 17:17404554-17404576 CAGTGCCACCCAGCTGAACCTGG - Intergenic
1145060982 17:19733530-19733552 CAGTTGCCCCCAGCCGAAGGTGG - Intergenic
1148722375 17:49763508-49763530 CAGCGCCAGCCATCCGCACGGGG + Intronic
1165225705 19:34353062-34353084 CAGTGCGCCCCATCCCAGGGAGG + Exonic
1166623103 19:44322772-44322794 TAGTGCCACCCATCCCAAAAGGG + Intergenic
934857660 2:97739172-97739194 CAATGCCACACAGCCTAAGGAGG - Intronic
1176241193 20:64076710-64076732 CAGGGCTACCCATGGGAAGGTGG - Intronic
1182568345 22:31216509-31216531 CAGGGCCACCAATCTGGAGGTGG + Intronic
1185149560 22:49156268-49156290 CACAGCCACCCATCAGAAAGGGG - Intergenic
1185245085 22:49769271-49769293 CAGAGCCATCCCTCAGAAGGGGG + Intergenic
952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG + Intergenic
953373150 3:42406894-42406916 CACTGCCACGCATCTGAAAGAGG + Exonic
953670869 3:44960950-44960972 CAGGGCCACTCCTCCCAAGGTGG + Intronic
954914744 3:54139182-54139204 AAGTGCCACCCATCTCATGGTGG - Intronic
956596924 3:70977862-70977884 CGGTGGGACCCATCCGCAGGCGG - Exonic
960205612 3:114893808-114893830 CAGTGCCATCCATACAAATGGGG + Intronic
961482448 3:127192859-127192881 CAATGCCTCCCATCCGAGAGGGG + Intergenic
962755402 3:138462046-138462068 CAGTGCCACCCCTCCACAGCTGG + Intronic
965867363 3:173221240-173221262 AAGTGCCACCCATCCCAAACTGG + Intergenic
969570390 4:8004876-8004898 CATTGCCACCCCTCCAAAGAGGG - Intronic
970319628 4:14862672-14862694 GAGGGGCACCCATCCTAAGGTGG + Intergenic
985180472 4:187256100-187256122 CAGTGCCACTAATCCCAAGAGGG - Intergenic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1002964429 6:1948952-1948974 CAGTGCCAGCCAACAGAAGATGG - Intronic
1006333545 6:33409189-33409211 CACTGGCACCAATCTGAAGGAGG - Intronic
1010664767 6:78615695-78615717 CACTCCCACCCATGAGAAGGTGG + Intergenic
1019606184 7:1911356-1911378 CAGTGCTCCCCTTCCGAAGCTGG - Intronic
1024730099 7:52244237-52244259 CAGTGCCACCCATCCTTTTGGGG + Intergenic
1029474566 7:100775464-100775486 CAGTGCCAAGCATGAGAAGGAGG + Exonic
1029733392 7:102452093-102452115 CAGTGCCACCAGCCCGCAGGAGG - Exonic
1035673136 8:1435281-1435303 AAGTGCCATCCATCGGAAGCAGG + Intergenic
1038609353 8:29045556-29045578 CTGTGCCATCCTTCCGCAGGTGG + Intronic
1043306786 8:78805086-78805108 CAGTTTCATCCATCCCAAGGGGG + Exonic
1045046316 8:98282281-98282303 CTGTGCCACGGATCCGTAGGCGG + Intronic
1053285485 9:36847378-36847400 CAGAGCCACTCATCAGCAGGTGG - Intronic
1057262345 9:93592114-93592136 CCCTGCCACCCATCACAAGGTGG - Intronic
1059639230 9:116200288-116200310 CAATGACACCCAGCTGAAGGAGG - Intronic
1060730701 9:126035018-126035040 CAGAGCCACCAATGCCAAGGGGG + Intergenic
1186856180 X:13628378-13628400 CAGTTTGACCCATCAGAAGGTGG + Intronic
1189169459 X:38895103-38895125 CAATCCCACCCAACCCAAGGGGG - Intergenic