ID: 1113722006

View in Genome Browser
Species Human (GRCh38)
Location 13:112565249-112565271
Sequence CTTGCGAGTTATGGTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113722006 Original CRISPR CTTGCGAGTTATGGTGTTGT AGG (reversed) Intronic
906960530 1:50417043-50417065 CCTGGGAGTTATGGGGTTCTGGG - Intergenic
919679143 1:200416991-200417013 CTTAAGAGTTATGAAGTTGTTGG - Intergenic
924062680 1:240192512-240192534 CTTGTGGGTTATTGTTTTGTTGG - Intronic
1064936552 10:20684928-20684950 CCTGCCAGTTTTGGTTTTGTGGG - Intergenic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1082978300 11:59097240-59097262 CTTGCTATTTCTGGTGATGTTGG + Intergenic
1086303232 11:85452551-85452573 CATTCTAGTTATGGTGTTGGAGG - Intronic
1093269714 12:17044970-17044992 CAGGCGAGTTATAGTGTTGTTGG + Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1103826362 12:123742259-123742281 CTGGCCATTTTTGGTGTTGTTGG + Intronic
1108123232 13:47212510-47212532 CTGGTGGGTTATGGTGTTCTTGG + Intergenic
1111502063 13:89134385-89134407 CTGGGCAGTTATGGTGATGTTGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1116877033 14:50122304-50122326 CTTGCCAGTTATGATTTTGAGGG + Intronic
1136315771 16:29454053-29454075 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1136430348 16:30193395-30193417 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1141789491 16:86224838-86224860 ATTGGTAGTGATGGTGTTGTTGG + Intergenic
1159477193 18:68937126-68937148 CCTATGAGTTATAGTGTTGTTGG - Intronic
1167563761 19:50243050-50243072 GGTGCGAGTTACGGTGCTGTTGG + Intronic
925360805 2:3278789-3278811 GTTGCCAGTTATGGGGTTGCTGG - Intronic
931657526 2:64524106-64524128 CTTGCGAGTCATAGAGCTGTAGG - Intergenic
939345405 2:140959748-140959770 CTTGGAAGTTGTAGTGTTGTAGG - Intronic
939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG + Intergenic
944353668 2:198759514-198759536 CTTGCTACTTAGGGTGTGGTTGG - Intergenic
944437859 2:199710331-199710353 GGTGTGAGTTATGGTGCTGTTGG + Intergenic
946229631 2:218283285-218283307 CCTGCGAGTTCTGGGGTTCTGGG - Intronic
1173763019 20:45580944-45580966 GTAGCGAGTTATTGTATTGTAGG - Intergenic
953049400 3:39327234-39327256 CTTCCGAGTCAGGATGTTGTGGG + Intergenic
953993255 3:47499939-47499961 CTTCCGAGTCCTGGTGGTGTCGG + Intronic
958516992 3:95129717-95129739 TTTGCTAGTTGTGTTGTTGTGGG + Intergenic
992583551 5:78207842-78207864 CTTGCTGGTTATGGTACTGTTGG - Intronic
1002853498 6:1017497-1017519 CTTGAAAGTCATTGTGTTGTGGG + Intergenic
1008302075 6:49853559-49853581 TTTGGGAGGTATGGTGTTTTGGG - Intronic
1009248364 6:61268694-61268716 CTTGTGAGATATGGTGTTTCCGG - Intergenic
1012272384 6:97230071-97230093 CTTACGAATTAAGTTGTTGTTGG + Intronic
1014299023 6:119657230-119657252 TTTGTGAGTTATGATTTTGTTGG - Intergenic
1014775934 6:125510001-125510023 TTTGAGAGTTGTTGTGTTGTAGG + Intergenic
1015558078 6:134483268-134483290 CTTGCTAGTTGTGGTCTTGGGGG - Intergenic
1016324121 6:142880296-142880318 GGTGCAAGTTATGGGGTTGTTGG - Intronic
1017402540 6:154080775-154080797 CTTTGGATGTATGGTGTTGTGGG - Intronic
1019524701 7:1475723-1475745 CTGGAGAGTCGTGGTGTTGTGGG - Intronic
1024308208 7:47945817-47945839 CTTGGAAGTTATCCTGTTGTGGG - Intronic
1025617688 7:63137123-63137145 CTTGTGAGTAATGGTAGTGTAGG - Intergenic
1026638353 7:72103881-72103903 CTTGCGGGTTATCGTGTCCTTGG + Intronic
1046233126 8:111384085-111384107 CCTGGGATTTTTGGTGTTGTTGG + Intergenic
1052274341 9:26660736-26660758 CTGGCGATTTACAGTGTTGTGGG - Intergenic
1059718038 9:116931792-116931814 CATGGGAGTGATGGTGGTGTGGG + Intronic
1061569995 9:131471587-131471609 CTAGTCAGTTTTGGTGTTGTAGG + Intronic