ID: 1113724520

View in Genome Browser
Species Human (GRCh38)
Location 13:112588182-112588204
Sequence GCACGCGCGGCCGCGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113724520_1113724525 -3 Left 1113724520 13:112588182-112588204 CCCTGCGCCGCGGCCGCGCGTGC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1113724525 13:112588202-112588224 TGCGGCTGCCTAAGCGTTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 50
1113724520_1113724527 7 Left 1113724520 13:112588182-112588204 CCCTGCGCCGCGGCCGCGCGTGC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1113724527 13:112588212-112588234 TAAGCGTTCCCGGCCCTGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113724520 Original CRISPR GCACGCGCGGCCGCGGCGCA GGG (reversed) Intergenic
900227570 1:1540239-1540261 GCGCGCGCGGGCGGGGAGCAGGG + Intronic
900237547 1:1599945-1599967 GTCGGGGCGGCCGCGGCGCAGGG + Exonic
901075789 1:6554128-6554150 CAACGCGCGGCCGGGGCCCACGG + Exonic
901089889 1:6634251-6634273 GCACCTGCGGCAGAGGCGCACGG + Exonic
901641370 1:10694691-10694713 GCGCGCGCGGCGGGGGCGCGCGG - Intronic
902044273 1:13513553-13513575 GCCTGCGCCGCCGCGGCGCTCGG - Exonic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
905803829 1:40862054-40862076 CCATGGGCGGCCGCGGCGGACGG + Exonic
905886869 1:41496424-41496446 GCACGTTCGTCCGCCGCGCAGGG - Intergenic
906377036 1:45304102-45304124 GCGCGCGGGGCCGCGGGGCAGGG - Intronic
906637076 1:47416835-47416857 GCGCACGCGGCCGCGGCGCCAGG + Exonic
908401247 1:63774487-63774509 GCACGCGGGGCTGCTGCCCAAGG + Exonic
912411559 1:109483908-109483930 GGCCGCGCGGCGGCGGCGCCAGG + Intronic
917028326 1:170664778-170664800 GCACGCGGGGCGGCGGGGCTGGG + Intronic
917962321 1:180154837-180154859 GCAGGCGGTGCCGCGGCGCCGGG + Exonic
918066528 1:181105406-181105428 GCAACGGCGGCCGCGGCGCGCGG - Intergenic
921155065 1:212432952-212432974 GCAGCCGCCGCCGCGGCGCGGGG - Exonic
1065023198 10:21517329-21517351 GGGCGCGCGGCGGCGGCGCCCGG + Exonic
1065188913 10:23193201-23193223 GCCCGCGCCACCGCCGCGCAAGG - Exonic
1066429255 10:35336596-35336618 GCACGCGTGTCCGCGCCGGACGG - Intronic
1069651680 10:70053646-70053668 GCACGCCCGCCCGCGGCGCCCGG - Intronic
1072169927 10:92848910-92848932 GAACGCGGGGCCGCAGCGCGGGG - Intronic
1072591483 10:96832239-96832261 GCACGCCCAGCCGCGTCGCCCGG - Intronic
1073287925 10:102399512-102399534 GCACGGGCGGTCGGGGCGCCGGG + Intronic
1074055993 10:109923335-109923357 ACACGCGCGGCCGCGCAGCGAGG + Intronic
1076792537 10:132784928-132784950 GCCCGTGCGGCGGCGGCGCGGGG - Exonic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1077124323 11:925745-925767 GCGCGCGCGTCCGCGGCACGGGG - Intronic
1077386072 11:2270101-2270123 GCACGTGCTGCCGCAGCGCCTGG + Exonic
1077491445 11:2862709-2862731 GCACGCCCGGCCGCGGCTCCCGG - Intergenic
1077495796 11:2885978-2886000 GGGCGCGCGGCCGGGGCGCGCGG + Intergenic
1078066374 11:8081608-8081630 GGATACGCGGCCGGGGCGCAGGG + Intronic
1079076345 11:17387501-17387523 GCAGAGGCGGCCGTGGCGCAGGG + Exonic
1083933470 11:65858285-65858307 GCGAGCGAGGCGGCGGCGCAGGG - Exonic
1088663794 11:112074337-112074359 CCACGCGAGGCTGCGGCGCACGG + Exonic
1091222857 11:133939657-133939679 GCAAGCGCAGCAGGGGCGCACGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1100540000 12:95548734-95548756 GGGCGCGCGGCCGCGGCGATTGG - Intronic
1104860496 12:131921011-131921033 GCACCCACGGCAGCGGCCCAGGG - Intronic
1108314040 13:49220789-49220811 GAGCGCGCGGACGCGGCGCCGGG - Exonic
1113493985 13:110713803-110713825 GCAGCGGCGGCCGCGGCGCTGGG + Intronic
1113724520 13:112588182-112588204 GCACGCGCGGCCGCGGCGCAGGG - Intergenic
1118463889 14:66013697-66013719 GCACTACCGGCAGCGGCGCAGGG - Intergenic
1118809040 14:69260524-69260546 GCGCCCTCGGCCGCCGCGCAGGG - Intronic
1123040323 14:105487705-105487727 GGGCGCGCGGGCGCGGGGCAGGG - Intronic
1124109529 15:26773152-26773174 GCGCGCGCGGGCGCGGGGCGGGG + Intronic
1128788189 15:70413539-70413561 GCACTCGCAGCCACGGCTCAGGG - Intergenic
1129052846 15:72796992-72797014 GCGAGAGCGGCCGCGGCGCGGGG + Intergenic
1130224578 15:82047066-82047088 GCATGCTCGGCCGCGGGGCACGG - Intergenic
1131367605 15:91853537-91853559 GCAGGCGCGGCCGGCGGGCAAGG + Intergenic
1132320191 15:100919600-100919622 GCACGGGGGGCCGTTGCGCAGGG + Intronic
1132398180 15:101489393-101489415 GACCGCGTGGCGGCGGCGCACGG - Exonic
1132719778 16:1309887-1309909 GAAAGCTCGGCCGCGGCGCGGGG - Intronic
1132721434 16:1318189-1318211 GCAGACGGAGCCGCGGCGCAGGG + Intronic
1132891202 16:2205686-2205708 GCATGCGCAGCCGCAGCGCTCGG + Intronic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1134134170 16:11668629-11668651 GCGCGCGCGGCGGCGGGGCCGGG + Intronic
1135607330 16:23836022-23836044 GCTCTGGCGGCCGCGGCGCGCGG - Exonic
1136316176 16:29455729-29455751 GCACGTGCGGCGGCGGCGGGAGG - Exonic
1136430753 16:30195071-30195093 GCACGTGCGGCGGCGGCGGGAGG - Exonic
1137454848 16:48610203-48610225 GCATGCGCGGCGGCGGGGCCCGG - Exonic
1141832163 16:86515886-86515908 CCACGCGCAACCACGGCGCACGG - Intergenic
1141960792 16:87406639-87406661 GCACGTGAGGCCGCGGCGGATGG + Exonic
1142350067 16:89575734-89575756 GCTCGGGCGGCCGCCGCGCGGGG - Intergenic
1142989956 17:3723868-3723890 GCGGGCGCGTCCGCGTCGCACGG + Intronic
1143015401 17:3888830-3888852 ACACACGCGGCCGGGGCGCCAGG - Intronic
1145094155 17:20009819-20009841 GCACGCCCGGCCCCGGCTCCTGG + Intronic
1146794284 17:35770221-35770243 GCGCCCGCGGCGGCGGCTCAGGG + Exonic
1147429624 17:40363417-40363439 GCGCGCGCGGCGGGCGCGCAGGG + Exonic
1150249910 17:63699712-63699734 GGACGCCCGGGCGCGGCGCAGGG - Intronic
1151314183 17:73311760-73311782 GGATGCGAGGCCGCGGCGCGGGG - Intronic
1151780263 17:76240645-76240667 GCGCGCGTGGACGCGGCCCAGGG + Intergenic
1151812477 17:76452773-76452795 GCGCACGTAGCCGCGGCGCAGGG + Exonic
1151831972 17:76558119-76558141 ACACGCGCGGCGGAGGCGCACGG - Intergenic
1151919145 17:77140867-77140889 GCGTGCGCGGCCGCGGCCGAGGG - Intronic
1152245560 17:79183077-79183099 CCGCGCTCGGCCGCCGCGCAGGG + Intronic
1152867865 17:82735184-82735206 GCACGCGCTGACCCGGCCCAGGG - Intergenic
1158434826 18:57428345-57428367 GCTCTCGCAGCCTCGGCGCAGGG - Intergenic
1158530516 18:58256143-58256165 GCACGTGCGGCCGCCGCGTGCGG + Intronic
1160566665 18:79790253-79790275 CCACGCGAGGCGGCAGCGCATGG + Intergenic
1160828966 19:1093967-1093989 TGAGGGGCGGCCGCGGCGCACGG - Exonic
1160908949 19:1466028-1466050 GCACCCGCTGCTGCGGCTCAAGG + Exonic
1161006769 19:1941113-1941135 GCAGCCGCGGCCACGGCGCCGGG - Intergenic
1161207182 19:3047195-3047217 TTAGGCGCGGCCGCGGCGCGGGG + Intronic
1161265156 19:3360341-3360363 GCGCGCGCGGCAGCGGGGCCGGG - Intronic
1162776612 19:12983642-12983664 GCACGCGCGGCCCGCGCGCAGGG - Intergenic
1164595861 19:29530314-29530336 GCACGCGCGGGGATGGCGCAGGG + Intronic
1164647761 19:29872319-29872341 GCACCCGCGGGCGGGGAGCAGGG - Intergenic
1165157227 19:33796050-33796072 GCAGCCGCCGCCGCGGCGCCCGG - Intronic
1165767778 19:38361747-38361769 GGACGCGCGGCGGCCGCGCCCGG - Exonic
1166094449 19:40530440-40530462 GGGCGCGCGGCCGCCGCGCGGGG + Intronic
925068869 2:950894-950916 GCGGGCGCGGACGCGGCGCCTGG + Exonic
927472209 2:23385220-23385242 GCTGGCGCGGCCGCGGCGCGGGG - Exonic
932611449 2:73202990-73203012 CCACGCGCGGCCCTGGCACAGGG - Exonic
934487986 2:94735822-94735844 CCACGCGCGGTAGCGCCGCATGG + Intergenic
944716111 2:202377003-202377025 GGACGGGCGGCGGCGGCGCCCGG - Exonic
948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG + Intergenic
1171427512 20:25058012-25058034 GCCCGCGCGGCCGCCGTGCGGGG - Exonic
1174380713 20:50153736-50153758 GCCCGCGCCGCCGCCGCGCCCGG - Intergenic
1175439550 20:58981206-58981228 GCACGCGCGGCCGCGCGCCTCGG - Exonic
1176217914 20:63957000-63957022 GGACGCCCGGCCGCGAGGCAGGG + Exonic
1176548987 21:8213474-8213496 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176556880 21:8257686-8257708 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176567916 21:8396504-8396526 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176575820 21:8440723-8440745 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1179908702 21:44436987-44437009 GCCAGCCCCGCCGCGGCGCAGGG + Intronic
1181081441 22:20418391-20418413 GCACGCGCGGCGCCGGCCCTTGG - Intergenic
1183708215 22:39487820-39487842 GCACGGGGGGCCGAGGCGCCCGG + Exonic
1184680709 22:46071117-46071139 GCCCGCGCGGCCGAGGCGGGCGG - Intronic
1184680771 22:46071272-46071294 GCACGCGGGGCTGCGGGGCGAGG + Intronic
1184698003 22:46150495-46150517 GGACGCGCGGAGGCGGCGCCGGG + Intergenic
1185278856 22:49961379-49961401 GCACGGGCGGCGGCGGCGGCGGG + Intronic
1203253871 22_KI270733v1_random:129781-129803 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1203261927 22_KI270733v1_random:174860-174882 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
950902999 3:16513711-16513733 GGACGCGCGGCGGCGGCGGCGGG - Intronic
952287304 3:31981257-31981279 GCACGCGCGGCCCGGGCGTCCGG - Exonic
952867232 3:37862128-37862150 GCGCGCGGGGGCGCGGCGCGGGG - Intronic
953549936 3:43894334-43894356 GCCCGCTCCGCCCCGGCGCAGGG + Intergenic
954228633 3:49199471-49199493 GCACGCGCGGCCCCGCCCCCAGG - Intronic
954664757 3:52245872-52245894 GCCCAGGCGGCCGCGGCGCGGGG - Intronic
959849823 3:111072387-111072409 ACCCGCGCGGCCGCGGGGGAGGG - Intronic
961698970 3:128726664-128726686 GCGCGTCCTGCCGCGGCGCAGGG - Intronic
961742993 3:129045890-129045912 GCAGGCGCGGGAGCAGCGCAGGG - Intergenic
967924153 3:194633282-194633304 GCACGCGGGGCGGCGGCGCTCGG - Exonic
968514951 4:1011966-1011988 GCGCGCGCGGCCGCGACCCCAGG + Intronic
968701054 4:2058645-2058667 GCATGCGCGGCCGCGGGGGGCGG + Intergenic
969256923 4:6008460-6008482 GCAGGAGCGGTTGCGGCGCAAGG - Intergenic
970456346 4:16226983-16227005 GCTGGCGCGGCCGCGGCGGCGGG + Intronic
971317683 4:25580974-25580996 GCCCGCCTGGCGGCGGCGCAAGG - Intergenic
975778764 4:77818901-77818923 ACACGCGCGGCAGCGGGGCTGGG - Intronic
981348340 4:143700354-143700376 GGACGCCCTGCCGCGGCTCAAGG - Exonic
982564702 4:156972003-156972025 GCTCGCGCGGACGCGTCCCAGGG - Intergenic
983792298 4:171813286-171813308 GGACGCGAGGCAGCGGCGGAGGG - Intronic
992515991 5:77492510-77492532 GCACGCGCGGGAGCGCCGCCGGG + Exonic
995623752 5:114055480-114055502 GAACGCGCCGCGGCGGCGGAGGG - Intergenic
997177745 5:131796850-131796872 GCGCGCCCGGCCGCGACGCCCGG - Exonic
997984482 5:138492017-138492039 GCAGCCGCGGGCGGGGCGCAGGG - Intergenic
1001563326 5:172684100-172684122 GCCCGCGACGCCGCCGCGCACGG - Exonic
1001906705 5:175478921-175478943 GCGCGCGGGGACGCGGCGGAGGG - Intronic
1002926907 6:1610224-1610246 GCCCGCGCGGCCGCGAGGCGGGG - Exonic
1003325330 6:5086101-5086123 AGACGCTCGGCCGCGGCGCTCGG - Exonic
1008597986 6:53061938-53061960 GCTCGCGCGGCCGAGCCGCCAGG + Intronic
1012939672 6:105403222-105403244 GCCCGCGCCGCCCGGGCGCACGG + Intergenic
1019626196 7:2016930-2016952 CAACGCGCGGACGCCGCGCAAGG + Intronic
1026807094 7:73435457-73435479 GGCCCCGCGGCCGCTGCGCATGG - Exonic
1029536997 7:101162952-101162974 GCGCGCGCGGCGGGGGCGCGCGG + Exonic
1029849330 7:103446067-103446089 GCGCGGGCGGCCGCGGGGCCGGG - Intronic
1029896464 7:103989612-103989634 GCAGAGGCGGCGGCGGCGCACGG - Intergenic
1032344371 7:131105998-131106020 GGAGGCGCGGTCGCGGCGCCGGG - Intergenic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1034262398 7:149765145-149765167 GCACGCGCGGGTGCCGCGCCAGG + Exonic
1034622246 7:152464616-152464638 GCACGCGTGGGCGCGGCGGGTGG - Intergenic
1036561845 8:9905188-9905210 ACACGCGTGGCCGCTGCGGAAGG - Intergenic
1039608393 8:38901114-38901136 CCCCGCGCGGCCCCGGCGCCCGG + Intergenic
1039897370 8:41725714-41725736 CCACGGGCGTCCGCGGCCCAAGG + Intronic
1041068145 8:54101862-54101884 GGGCGCCCGGCCGCGGCCCAAGG + Exonic
1042039986 8:64580522-64580544 CCATGCGGGGCCGCGGCCCATGG + Exonic
1043844962 8:85152950-85152972 GCACCAGGGGCCGCGGAGCAGGG - Intergenic
1049212182 8:141391917-141391939 GGGCGCGCGGCCGCGGCGTGGGG + Intergenic
1049645500 8:143733963-143733985 GGGCGCGCGGCCGCAGGGCACGG - Intergenic
1053669811 9:40348597-40348619 CCACGCGCGGTAGCGCCGCATGG - Intergenic
1053919609 9:42974852-42974874 CCACGCGCGGTAGCGCCGCATGG - Intergenic
1054514801 9:66027699-66027721 CCACGCGCGGTAGCGCCGCATGG + Intergenic
1057063520 9:92026629-92026651 GGACGCGCGGCCGCGAGGCAGGG - Intergenic
1057488791 9:95506704-95506726 GCGCGGGTGGCCGCGGCACACGG + Intronic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061181649 9:129028160-129028182 GCCCGCACGGCCGCCGCGCACGG + Exonic
1061897252 9:133654925-133654947 GCAGGCGCGGCCCCGGGGCCAGG + Intronic
1062589517 9:137267109-137267131 GCAGGGGTGGCCGTGGCGCAGGG + Intronic
1202800345 9_KI270719v1_random:169990-170012 GCAGGCGCGGAGGGGGCGCAGGG + Intergenic
1203470271 Un_GL000220v1:112925-112947 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1203478092 Un_GL000220v1:156897-156919 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1187507264 X:19887750-19887772 GGACGCGCGGCCGCCGGGCGGGG + Intergenic
1195923183 X:110002672-110002694 GCGGCCGCCGCCGCGGCGCACGG - Intronic
1200229453 X:154436890-154436912 GCGCGCGCGGCTCCCGCGCACGG + Intergenic
1200244579 X:154516189-154516211 GGACGCAAGGCCGCTGCGCAGGG + Exonic