ID: 1113725066

View in Genome Browser
Species Human (GRCh38)
Location 13:112592468-112592490
Sequence TAACCTTCACCCAGTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113725066_1113725070 6 Left 1113725066 13:112592468-112592490 CCCACGGCACTGGGTGAAGGTTA 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1113725070 13:112592497-112592519 TCTGTGAAGACAGCAGTGAAGGG 0: 1
1: 0
2: 1
3: 45
4: 367
1113725066_1113725069 5 Left 1113725066 13:112592468-112592490 CCCACGGCACTGGGTGAAGGTTA 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1113725069 13:112592496-112592518 GTCTGTGAAGACAGCAGTGAAGG 0: 1
1: 0
2: 1
3: 29
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113725066 Original CRISPR TAACCTTCACCCAGTGCCGT GGG (reversed) Intergenic
902131941 1:14269507-14269529 TAATCTTCTCCCAGTTCCCTGGG - Intergenic
908571925 1:65420096-65420118 TAACCCCAACCCAGTGCCCTGGG - Intergenic
913112305 1:115667425-115667447 TAACCTCTGCCCAGTGCCCTAGG + Intronic
924462509 1:244271991-244272013 TAACATTCACACAGTGCTTTTGG + Intergenic
1062805511 10:416808-416830 AAACCATCACCCAGAGCTGTGGG + Intronic
1070189638 10:74100062-74100084 TAAACCTGACCCAGTGCTGTTGG + Intronic
1072567076 10:96625630-96625652 TAGCATTCACCCAGAGCCCTAGG - Intronic
1074756709 10:116629154-116629176 CATCCTTCACCCAGTGCCTTGGG - Intronic
1078463567 11:11533557-11533579 TAGCCCTGACTCAGTGCCGTAGG - Intronic
1079492957 11:21009977-21009999 TAATCTTCTCCCTGTGCTGTGGG + Intronic
1090984813 11:131756816-131756838 TAAATTTCACCCAGTACCCTAGG - Intronic
1113725066 13:112592468-112592490 TAACCTTCACCCAGTGCCGTGGG - Intergenic
1126535152 15:49753411-49753433 TGACCTTCACCCAGAGCCACAGG - Intergenic
1130094458 15:80845701-80845723 TAACCTTCCCACAGTGACTTTGG + Intronic
1130401476 15:83558792-83558814 GAACCTACTCCCAGTGCCGTGGG + Intronic
1133395546 16:5444345-5444367 TAAATTTCACCCAGTTCCTTTGG + Intergenic
1135173277 16:20205560-20205582 TAAACTTCTCCAAGAGCCGTAGG - Intergenic
1147582962 17:41637150-41637172 GAAGCTTCCCCCAGTGCCCTGGG + Intergenic
1148487654 17:48001318-48001340 TAGCCTTCACCCTCTGCTGTGGG - Intergenic
1150826707 17:68482606-68482628 TAACCTTCACCCGGTGTCTAGGG - Intergenic
1151887958 17:76934235-76934257 TAACCTTCACACAATGAGGTAGG + Intronic
1153364626 18:4241653-4241675 TATCCTCCAGCCAGTGCTGTTGG - Intronic
930624873 2:53685923-53685945 GAAGCTTCATCCAGTGCCTTGGG + Intronic
930859220 2:56052560-56052582 TAACCATCACCCAGTGAGGTGGG + Intergenic
935794273 2:106626081-106626103 TCACCTTCACCAAGTGACGAAGG - Intergenic
948284897 2:236776351-236776373 TAACCTTTATCCTGTGCCATAGG - Intergenic
948415551 2:237800093-237800115 GAACCTTCATCCATTGCCGATGG - Intronic
1172635423 20:36406754-36406776 TCCCCTTCACCCAGGGCAGTGGG + Intronic
1174523460 20:51152821-51152843 GAACTCTCACCCACTGCCGTTGG + Intergenic
1177949324 21:27514236-27514258 TAACATTCACTCAATGCCCTAGG - Intergenic
1180799907 22:18626897-18626919 ACACCTGCACCCAGTGCTGTAGG - Intergenic
1181221808 22:21368369-21368391 ACACCTGCACCCAGTGCTGTAGG + Intergenic
1181637194 22:24180008-24180030 TCCCCTGCACCCAGTGCTGTAGG + Intergenic
957019891 3:75113844-75113866 TATCCTTCAACCAGTCCTGTTGG - Intergenic
958050066 3:88333791-88333813 TATCCTTTATCCAGTCCCGTAGG - Intergenic
959814883 3:110663393-110663415 TAACCTTCACCCTAAGCCATAGG + Intergenic
964814747 3:160704740-160704762 TATCTTTCATCCATTGCCGTAGG - Intergenic
964935535 3:162081019-162081041 TAACATTCACCCAGTTCAGGTGG + Intergenic
968192346 3:196677951-196677973 GAACCTTGACCCAGTGCTGACGG - Intronic
968823149 4:2871664-2871686 TAACCTTCATCCAGTGTCAGTGG + Intronic
971754935 4:30695403-30695425 TAACCTGGGCCCAGTGCAGTGGG + Intergenic
972213320 4:36865347-36865369 GAACCTTCATCCATTGCTGTTGG + Intergenic
975284589 4:72602600-72602622 TATCCTTGACACAGTGCCTTTGG - Intergenic
983897199 4:173094126-173094148 TAGCCTTCACCAATTGCCTTTGG + Intergenic
986917561 5:12640931-12640953 CAACCTTGACCCAATGCTGTTGG + Intergenic
988239712 5:28593914-28593936 TAGCCATCACCCAGAGCCATTGG + Intergenic
990973061 5:61530734-61530756 TTACCTCCACCCACTGCCCTTGG - Intronic
992096883 5:73371014-73371036 AAAACTTCTCCCAGTGCCGGAGG + Intergenic
994097657 5:95861556-95861578 TTACATGCAGCCAGTGCCGTCGG - Intergenic
997074408 5:130654940-130654962 GACCCTTCACCCAATGCCTTAGG + Intergenic
999124410 5:149236359-149236381 TAACATTCTCCCAATGCCATAGG - Intronic
1011724960 6:90201335-90201357 TAACATTTACCCAGTGAAGTTGG - Intronic
1012683369 6:102210705-102210727 TAATTTTCACCCATTGCAGTTGG - Intergenic
1021926734 7:25541094-25541116 TAATCTTCACCCATTTCTGTAGG - Intergenic
1031691766 7:124797269-124797291 TATCCTTCCCCCAGTGTCCTAGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1041938206 8:63357972-63357994 AAACATTCACCCACAGCCGTGGG - Intergenic
1049537289 8:143188298-143188320 TATACATAACCCAGTGCCGTCGG + Intergenic
1056913765 9:90727715-90727737 TCACCTTCTCCCAGTGCGGCAGG - Intergenic
1062286141 9:135773376-135773398 CATCCTCCACCCAGTGCCCTAGG + Intronic
1189180502 X:39000137-39000159 TAACTGTCACACAGTGCAGTTGG - Intergenic
1190690538 X:52909725-52909747 AATCCTCCACACAGTGCCGTGGG + Intergenic
1190695445 X:52946067-52946089 AATCCTCCACACAGTGCCGTGGG - Intronic