ID: 1113725131

View in Genome Browser
Species Human (GRCh38)
Location 13:112592786-112592808
Sequence CCGTGTCTGAAGGCTGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113725131_1113725138 11 Left 1113725131 13:112592786-112592808 CCCGCAACAGCCTTCAGACACGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1113725138 13:112592820-112592842 CCACACACCATGAGGCAGCCAGG 0: 1
1: 0
2: 2
3: 29
4: 212
1113725131_1113725136 3 Left 1113725131 13:112592786-112592808 CCCGCAACAGCCTTCAGACACGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1113725136 13:112592812-112592834 TGCACTGGCCACACACCATGAGG 0: 1
1: 0
2: 2
3: 7
4: 146
1113725131_1113725141 16 Left 1113725131 13:112592786-112592808 CCCGCAACAGCCTTCAGACACGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1113725141 13:112592825-112592847 CACCATGAGGCAGCCAGGTGGGG 0: 1
1: 0
2: 2
3: 40
4: 283
1113725131_1113725140 15 Left 1113725131 13:112592786-112592808 CCCGCAACAGCCTTCAGACACGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1113725140 13:112592824-112592846 ACACCATGAGGCAGCCAGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 213
1113725131_1113725139 14 Left 1113725131 13:112592786-112592808 CCCGCAACAGCCTTCAGACACGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1113725139 13:112592823-112592845 CACACCATGAGGCAGCCAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113725131 Original CRISPR CCGTGTCTGAAGGCTGTTGC GGG (reversed) Intergenic
901415161 1:9111399-9111421 ACGTGTCTGTGGGCTGGTGCTGG - Exonic
901879377 1:12185032-12185054 CCTTCCCTGAAGGCTGCTGCTGG - Intronic
902087174 1:13872624-13872646 CAGTGTGCCAAGGCTGTTGCAGG + Intergenic
903366518 1:22808708-22808730 CCGTGTCATAAGGGTGTTACGGG - Intronic
905105370 1:35560620-35560642 CAGTGCCTGACGGCTGTAGCAGG + Exonic
916047162 1:161008621-161008643 CCAACTCTAAAGGCTGTTGCAGG - Intronic
919602700 1:199641837-199641859 CCGTGTCTAATGGCAGTTACTGG - Intergenic
919827587 1:201514442-201514464 CTGTGGCTGGAGGCTGATGCTGG + Intergenic
922719917 1:227895116-227895138 CCGTGTCTCCATGCTGTTGATGG - Intergenic
1063028891 10:2211491-2211513 TAGTGGCTGATGGCTGTTGCTGG - Intergenic
1076482953 10:130796743-130796765 TCGTGTCTGATTGCTGGTGCAGG + Intergenic
1078969558 11:16391627-16391649 CCCAATCTGAAGGCTGTTGAAGG - Intronic
1085288414 11:75379455-75379477 CCGTGTCTGAAAGAAGTTTCTGG + Intergenic
1088972781 11:114788180-114788202 CCGTGTTGAAAGGCTGATGCTGG - Intergenic
1090833401 11:130436168-130436190 CAGTGTCTGTAGGCTGAGGCAGG - Intergenic
1091223408 11:133944157-133944179 CGGTGCCTGAGGGCTGTTTCCGG - Intronic
1096252489 12:50041949-50041971 CCCTGACTGAAGGCTGGTCCTGG + Intergenic
1101063726 12:100997881-100997903 ACTTTTCTGAAGGCTGTTTCTGG + Intronic
1102635326 12:114318670-114318692 CATTGTCTGAGGGCTGTTCCTGG - Intergenic
1113462788 13:110493484-110493506 CGGTTTCTCAAGGCAGTTGCTGG + Intronic
1113725131 13:112592786-112592808 CCGTGTCTGAAGGCTGTTGCGGG - Intergenic
1116775092 14:49170218-49170240 TCTTGTCTGATTGCTGTTGCTGG + Intergenic
1120655250 14:87181429-87181451 CCCTGTCTCCAGTCTGTTGCAGG - Intergenic
1121602185 14:95213545-95213567 CCCTTTCTGATGGCTGTGGCAGG + Intronic
1127710732 15:61595235-61595257 CCGTGTCTGGTGGCTGATGCTGG + Intergenic
1128144191 15:65323293-65323315 CCGCGTCTGGTGGCTGATGCTGG - Intergenic
1130455184 15:84098877-84098899 CTGTCCCTGAATGCTGTTGCAGG + Intergenic
1130534088 15:84770814-84770836 GCCTGTCTGAAGGCCGCTGCTGG - Intronic
1132575135 16:660645-660667 CTGCGTCTGAAGGCTGTCGTCGG + Exonic
1134227227 16:12400396-12400418 CCATCTCTGAAGGTTGTTGTAGG - Intronic
1141462586 16:84186645-84186667 CCTTGTCTGAGGGCTTTTGTGGG - Intronic
1144295684 17:13872928-13872950 CTGTCTCTGACGGCTTTTGCAGG + Intergenic
1145844801 17:28029269-28029291 CCTTGACTGAAGGCTTTTTCTGG + Intergenic
1149852196 17:60044551-60044573 CAGTGTCTGGATGCTGTTGCAGG - Intronic
1153957789 18:10112864-10112886 CAGTGTCTGAAGGCTCCTCCTGG - Intergenic
1154499458 18:14988008-14988030 CCAGCTCCGAAGGCTGTTGCTGG - Intergenic
1156693519 18:39737319-39737341 AAGAGTCTGAAGGCTCTTGCAGG + Intergenic
1162415746 19:10536034-10536056 CCCTGTCTGAAGGCTCTAGAGGG + Intergenic
1163099724 19:15087479-15087501 CCCTGTCTGTGGGCTGCTGCTGG + Exonic
1168125263 19:54279254-54279276 CCGTGTCTCAGGGCAGTTCCAGG - Intronic
1168375906 19:55879071-55879093 CCTTGTCTCAGGGTTGTTGCAGG + Intronic
1168554529 19:57326872-57326894 CCCTGTCTGAAGGCGGGTGGGGG - Intronic
926733038 2:16051500-16051522 TGGTGTCTGAAGGCTGCTGAGGG + Intergenic
927883992 2:26707319-26707341 CCCTGTCGGAAGGCAGTGGCTGG - Intronic
932700171 2:73986132-73986154 CCTTTTCTGAGGGCTGCTGCTGG + Intergenic
933513292 2:83268632-83268654 CCATGTCTCATGGCTGTTTCTGG - Intergenic
936611008 2:114001932-114001954 GAGTGTCTGAAGACTGCTGCAGG + Intergenic
936986231 2:118313619-118313641 ACGTGTCTGGAGGGTGATGCTGG + Intergenic
938118722 2:128619487-128619509 CTGTGTGGGAAGGCTGTGGCAGG + Intergenic
941837644 2:170043290-170043312 CAGTGTCTGAGAGCTGTAGCTGG + Intronic
948553026 2:238787353-238787375 GCGTGTATGAATGCTGTTGCTGG - Intergenic
1168928365 20:1601014-1601036 ACGTGTTTGATGGCTGTTGCTGG + Intronic
1171296184 20:24019108-24019130 CCTTGGCTGAAGGCTGCTCCTGG - Intergenic
1172187742 20:33041830-33041852 CCTGGTCTGAAGGCTGTAGAGGG + Intronic
1175801057 20:61801197-61801219 CAGTGTCTGCAGGCTGCAGCGGG + Intronic
1182114786 22:27749900-27749922 CCTTTTCTGAAAGCTGTTCCTGG - Exonic
1184268424 22:43363400-43363422 CTGTGCCTGAGGGATGTTGCTGG + Intergenic
1185070933 22:48655210-48655232 CCGTGTCTGAAGGGGCTGGCAGG + Intronic
1185119526 22:48957685-48957707 TCGGGTCTGAAGGCTGCTGTGGG - Intergenic
950005882 3:9690642-9690664 CCGTGGCTGAAGGGCGCTGCAGG + Intronic
954701635 3:52453784-52453806 CCGGGTCTGAAGGGTGGTGGAGG - Intronic
957632886 3:82740752-82740774 CAGTGTCTGAAGGGAGTTTCAGG - Intergenic
958624737 3:96609658-96609680 CAGTGTCTGAAGGCAGCAGCAGG + Intergenic
962241778 3:133756280-133756302 AGGTGTCTGAAGGATGGTGCTGG + Exonic
963495057 3:146047774-146047796 CCTTGCCTGAAGGCTGGTGCAGG - Intergenic
964719945 3:159761523-159761545 ACATATCTGCAGGCTGTTGCTGG + Intronic
968901336 4:3433361-3433383 CCCTACCTCAAGGCTGTTGCTGG - Intronic
974752647 4:66160748-66160770 CCATGTCTGAAGGATCTTTCAGG + Intergenic
977435688 4:96991329-96991351 CAATGTTTGAAGGCTGTGGCAGG + Intergenic
977836809 4:101654966-101654988 CAGTGTCTTAAGGAAGTTGCAGG - Intronic
988873737 5:35420227-35420249 CTGTGTGTGAAGGGTGTTGAGGG - Intergenic
995566015 5:113433747-113433769 GCGTCTCTGGAGGCTGTTGGGGG + Exonic
996119208 5:119652140-119652162 CCCTGGCTGAGGGCTGTTCCTGG - Intergenic
996235314 5:121121884-121121906 ACGTGTCTGGCGGTTGTTGCTGG - Intergenic
997224794 5:132201424-132201446 CCTGGTGTGAGGGCTGTTGCTGG + Intronic
1000717123 5:164658761-164658783 CTGTGGCTAAAGGCTGTTTCTGG - Intergenic
1001670923 5:173473219-173473241 CAGTCTCTGATGGCTGTTGATGG - Intergenic
1005293731 6:24403250-24403272 CAGCGTCCCAAGGCTGTTGCCGG - Intronic
1009678065 6:66853031-66853053 TCTTGTCTGAATGCTTTTGCTGG + Intergenic
1011354076 6:86455422-86455444 CAGTTACTGAAGGCTGTGGCAGG + Intergenic
1011665324 6:89627648-89627670 CTGTGTCTGAGTGCTGTTGCAGG - Exonic
1012827224 6:104162126-104162148 CTGTGCCACAAGGCTGTTGCCGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017335236 6:153250587-153250609 CTATCTCTGAAGGCTGTAGCGGG + Intergenic
1019265167 7:111081-111103 CCGTGTCTGCAGGTGGGTGCTGG - Intergenic
1022024815 7:26437757-26437779 CCTTTGCTGAAGGCTGTAGCTGG + Intergenic
1022703627 7:32783683-32783705 CTGTTTCTGAAGCCTGTTCCTGG - Intergenic
1022907869 7:34873812-34873834 CTGTTTCTGAAGCCTGTTCCTGG - Intronic
1045472192 8:102522460-102522482 TCTTGCCTGAAGGCTGTTTCTGG + Intergenic
1049475073 8:142793544-142793566 CCCTGTCTTCAGTCTGTTGCTGG + Intergenic
1049570372 8:143367554-143367576 CCTTATGAGAAGGCTGTTGCTGG + Intergenic
1050375643 9:4970093-4970115 TCTTGTCTGAAGGATGTTGATGG - Intergenic
1053064942 9:35061522-35061544 CAGTGTCTCTAGGCAGTTGCTGG - Intronic
1059498137 9:114727214-114727236 CAGTGTGTGAAGGCTGAGGCTGG - Intergenic
1061139099 9:128753538-128753560 CAGTGTCTGCAGGCTCTTGGCGG + Exonic
1061835340 9:133325033-133325055 CCCTGAGTGAAGGCTGTTCCTGG - Intergenic
1062333965 9:136056806-136056828 CCGGCTCTGATGGCTGATGCTGG - Intronic
1186196650 X:7116201-7116223 CCCTGACTGGAGGCTGTTGTGGG + Intronic
1190748392 X:53340525-53340547 CCCTGACTGGAGGCTGTTGGTGG - Intergenic
1201559837 Y:15304168-15304190 CAGTGTCTGAGGGCTGTCTCAGG + Intergenic