ID: 1113726476

View in Genome Browser
Species Human (GRCh38)
Location 13:112606495-112606517
Sequence CCACCCACACCGGCCGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113726467_1113726476 4 Left 1113726467 13:112606468-112606490 CCGACTCCGCCCAGGCCACGGGC No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726469_1113726476 -5 Left 1113726469 13:112606477-112606499 CCCAGGCCACGGGCTGCCCCACC No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726460_1113726476 15 Left 1113726460 13:112606457-112606479 CCAGGCCCTTCCCGACTCCGCCC No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726468_1113726476 -2 Left 1113726468 13:112606474-112606496 CCGCCCAGGCCACGGGCTGCCCC No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726458_1113726476 19 Left 1113726458 13:112606453-112606475 CCCGCCAGGCCCTTCCCGACTCC No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726470_1113726476 -6 Left 1113726470 13:112606478-112606500 CCAGGCCACGGGCTGCCCCACCC No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726462_1113726476 10 Left 1113726462 13:112606462-112606484 CCCTTCCCGACTCCGCCCAGGCC No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726459_1113726476 18 Left 1113726459 13:112606454-112606476 CCGCCAGGCCCTTCCCGACTCCG No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726463_1113726476 9 Left 1113726463 13:112606463-112606485 CCTTCCCGACTCCGCCCAGGCCA No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data
1113726465_1113726476 5 Left 1113726465 13:112606467-112606489 CCCGACTCCGCCCAGGCCACGGG No data
Right 1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113726476 Original CRISPR CCACCCACACCGGCCGCCTG AGG Intergenic