ID: 1113727875

View in Genome Browser
Species Human (GRCh38)
Location 13:112618562-112618584
Sequence TCTCAAGGCCTGAGTTAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113727875_1113727880 8 Left 1113727875 13:112618562-112618584 CCGTGTTAACTCAGGCCTTGAGA No data
Right 1113727880 13:112618593-112618615 TCGAGACGCTGAGCCCTGGGAGG No data
1113727875_1113727881 9 Left 1113727875 13:112618562-112618584 CCGTGTTAACTCAGGCCTTGAGA No data
Right 1113727881 13:112618594-112618616 CGAGACGCTGAGCCCTGGGAGGG No data
1113727875_1113727878 4 Left 1113727875 13:112618562-112618584 CCGTGTTAACTCAGGCCTTGAGA No data
Right 1113727878 13:112618589-112618611 GCTATCGAGACGCTGAGCCCTGG No data
1113727875_1113727879 5 Left 1113727875 13:112618562-112618584 CCGTGTTAACTCAGGCCTTGAGA No data
Right 1113727879 13:112618590-112618612 CTATCGAGACGCTGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113727875 Original CRISPR TCTCAAGGCCTGAGTTAACA CGG (reversed) Intergenic
No off target data available for this crispr