ID: 1113727878

View in Genome Browser
Species Human (GRCh38)
Location 13:112618589-112618611
Sequence GCTATCGAGACGCTGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113727874_1113727878 10 Left 1113727874 13:112618556-112618578 CCTACTCCGTGTTAACTCAGGCC No data
Right 1113727878 13:112618589-112618611 GCTATCGAGACGCTGAGCCCTGG No data
1113727875_1113727878 4 Left 1113727875 13:112618562-112618584 CCGTGTTAACTCAGGCCTTGAGA No data
Right 1113727878 13:112618589-112618611 GCTATCGAGACGCTGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113727878 Original CRISPR GCTATCGAGACGCTGAGCCC TGG Intergenic
No off target data available for this crispr