ID: 1113727880

View in Genome Browser
Species Human (GRCh38)
Location 13:112618593-112618615
Sequence TCGAGACGCTGAGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113727877_1113727880 -7 Left 1113727877 13:112618577-112618599 CCTTGAGAGGAAGCTATCGAGAC No data
Right 1113727880 13:112618593-112618615 TCGAGACGCTGAGCCCTGGGAGG No data
1113727874_1113727880 14 Left 1113727874 13:112618556-112618578 CCTACTCCGTGTTAACTCAGGCC No data
Right 1113727880 13:112618593-112618615 TCGAGACGCTGAGCCCTGGGAGG No data
1113727875_1113727880 8 Left 1113727875 13:112618562-112618584 CCGTGTTAACTCAGGCCTTGAGA No data
Right 1113727880 13:112618593-112618615 TCGAGACGCTGAGCCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113727880 Original CRISPR TCGAGACGCTGAGCCCTGGG AGG Intergenic
No off target data available for this crispr