ID: 1113735061

View in Genome Browser
Species Human (GRCh38)
Location 13:112672579-112672601
Sequence CCTCTTGGTGGGGCCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113735061_1113735071 9 Left 1113735061 13:112672579-112672601 CCCCAGCAGGCCCCACCAAGAGG 0: 1
1: 0
2: 2
3: 26
4: 256
Right 1113735071 13:112672611-112672633 AGTCCAGCCTCCACAGGCAGAGG 0: 1
1: 1
2: 3
3: 80
4: 438
1113735061_1113735072 10 Left 1113735061 13:112672579-112672601 CCCCAGCAGGCCCCACCAAGAGG 0: 1
1: 0
2: 2
3: 26
4: 256
Right 1113735072 13:112672612-112672634 GTCCAGCCTCCACAGGCAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 230
1113735061_1113735070 3 Left 1113735061 13:112672579-112672601 CCCCAGCAGGCCCCACCAAGAGG 0: 1
1: 0
2: 2
3: 26
4: 256
Right 1113735070 13:112672605-112672627 AAGCTGAGTCCAGCCTCCACAGG 0: 1
1: 0
2: 1
3: 27
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113735061 Original CRISPR CCTCTTGGTGGGGCCTGCTG GGG (reversed) Intronic