ID: 1113737563

View in Genome Browser
Species Human (GRCh38)
Location 13:112689698-112689720
Sequence TTTCCGGCAGGAACCCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113737555_1113737563 9 Left 1113737555 13:112689666-112689688 CCCATCGAGGCTTCCGGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 66
1113737558_1113737563 -4 Left 1113737558 13:112689679-112689701 CCGGGCGGAGGAGAAAAGTTTTC 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 66
1113737549_1113737563 24 Left 1113737549 13:112689651-112689673 CCGCGATCTCACTGCCCCATCGA 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 66
1113737547_1113737563 26 Left 1113737547 13:112689649-112689671 CCCCGCGATCTCACTGCCCCATC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 66
1113737548_1113737563 25 Left 1113737548 13:112689650-112689672 CCCGCGATCTCACTGCCCCATCG 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 66
1113737554_1113737563 10 Left 1113737554 13:112689665-112689687 CCCCATCGAGGCTTCCGGGCGGA 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 66
1113737556_1113737563 8 Left 1113737556 13:112689667-112689689 CCATCGAGGCTTCCGGGCGGAGG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113737563 Original CRISPR TTTCCGGCAGGAACCCGGGA AGG Intergenic
900528742 1:3142370-3142392 TCTCTGGCAGGAGCCAGGGAGGG - Intronic
901366149 1:8750416-8750438 TTTCCGGCTGGAACCATGGAGGG + Intronic
902724612 1:18326352-18326374 TTTCCAGCAGGAATGAGGGAGGG + Intronic
906021532 1:42633568-42633590 TTTCCACCAGGAAACCGGGAGGG + Intronic
911344459 1:96679613-96679635 TTTCCGGCTGGAACCATGGAGGG - Intergenic
912956258 1:114155696-114155718 TTTCCCCCAGGAACTCGCGAGGG - Intergenic
920630268 1:207645325-207645347 TCTCCGGTAGGACCCCGGGGTGG + Exonic
920641063 1:207752304-207752326 TCTCCGGTAGGACCCCGGGGCGG + Exonic
922213077 1:223500243-223500265 TTCCCCGCAGGATCCAGGGAGGG - Intergenic
924801342 1:247331448-247331470 TTTTCGGCCGGACGCCGGGAGGG - Exonic
1070764149 10:79047028-79047050 CTTAGGGCAGGAACACGGGAGGG - Intergenic
1072864829 10:99047624-99047646 TTTCTGGCTGGAACCATGGATGG + Intronic
1076362213 10:129897273-129897295 TTTCCTGCAGGGACCTAGGAGGG + Intronic
1077273412 11:1692380-1692402 ATTGCGGCAGCAACCGGGGATGG - Intergenic
1077284167 11:1758521-1758543 TCACCGGCAGGAGCCTGGGAGGG - Intronic
1091753909 12:3039615-3039637 TGGCCAGCAGGAACCGGGGATGG - Intronic
1093701010 12:22220728-22220750 TTTCCGTGAGGATCCTGGGAGGG - Intronic
1097900530 12:64868692-64868714 TTTCCAGCTGGAACCATGGAGGG - Intronic
1104849437 12:131864286-131864308 GTTCCAGCAGGAAGCCGGGATGG - Intergenic
1106247399 13:27961388-27961410 TTTCCGGCAGGACCCGGGCGAGG - Intergenic
1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118597662 14:67448606-67448628 TTTCCAGAAGGAAGCCTGGAGGG + Intronic
1124389094 15:29237690-29237712 TTTCCAGCAGCAACGCGTGAGGG - Intronic
1129220976 15:74131408-74131430 TGTCTGGCAGGAACCGGGAAGGG + Intronic
1142137215 16:88456917-88456939 CTTCCGGAAGGAGCCGGGGAGGG + Intronic
1142667509 17:1471189-1471211 TTCCCCGCAGGCACCCGGCACGG + Intronic
1144794523 17:17882086-17882108 TATCAGGAAGTAACCCGGGAGGG + Intronic
1147134745 17:38428422-38428444 GCGCCGGCAGGGACCCGGGAGGG - Exonic
1151405488 17:73883298-73883320 TGTCAGGCAGGAACCCGTGGAGG - Intergenic
1152178818 17:78805162-78805184 TTTTCTGCAGGAACCCTGGGAGG - Intronic
1157723163 18:49941545-49941567 TGTCAGGCAGGTACCCTGGAGGG + Intronic
1161829692 19:6593312-6593334 TTTCCGGCTGGAACCATGGAGGG + Intronic
1166154388 19:40899955-40899977 TTTCCTGCAGGCACAGGGGAGGG - Intergenic
929858020 2:45651894-45651916 TTTCCGTTAGGAACCCGGCGAGG + Exonic
945718492 2:213387846-213387868 TTTCCAGCAGAAACCCAGAAGGG - Intronic
1174436667 20:50511485-50511507 TTTCAGGCAGGGACTCAGGAAGG + Intronic
1174582699 20:51583633-51583655 TTTCCGGAAGCAAGCCGGGATGG - Intergenic
1175949028 20:62572654-62572676 TTTCCAGCAGGAACTGTGGACGG + Intergenic
1179460090 21:41528769-41528791 TCTCCGGCAGGAGTCTGGGAGGG + Intronic
1181148598 22:20866514-20866536 CTTCCGTCAGGAACCTGGGGAGG + Intronic
1183794750 22:40107058-40107080 TTTCCGGCTGGAACCACGGAGGG - Intronic
1183856453 22:40637951-40637973 TTTCCGGAAGGCTTCCGGGATGG + Intergenic
1183930418 22:41232977-41232999 TTTCTGGCTGGGAGCCGGGAAGG - Intronic
950178507 3:10894109-10894131 TGTCAGGCAGGAAACCAGGAGGG - Intronic
952723604 3:36558612-36558634 TCTAGGGCAGGAACCAGGGAAGG - Intergenic
953973580 3:47365894-47365916 TTTCCGCCAGCAATCTGGGAGGG + Intergenic
956121616 3:65971742-65971764 TGTCAGGCAGGAAGCTGGGAGGG - Intronic
961095772 3:124155254-124155276 TTTCTGGCTGGAACCATGGAGGG - Intronic
961506778 3:127375328-127375350 TTTCCTGCAGGAACCCTGTGGGG + Intergenic
962091005 3:132244258-132244280 TTTCCGGCTGGAACCATGGAGGG - Intronic
966982611 3:185152549-185152571 GTTCCGGCAGCGACCCCGGACGG + Intronic
972516838 4:39816937-39816959 ATTCCGGCAGGAATCCTGTAAGG - Intergenic
985149981 4:186937049-186937071 TTTCCTGCAGGAATGTGGGATGG - Intergenic
991509816 5:67364328-67364350 TATCAGGCAGTAACCAGGGAAGG - Intergenic
992523515 5:77582361-77582383 TTTCCGGCTGGAACCATGGAGGG + Intronic
992821367 5:80500318-80500340 TTTCCGGCTGGAACCATGGAGGG + Intronic
996884831 5:128342479-128342501 TTACCAGCAGGAAAACGGGATGG + Intronic
999235940 5:150094287-150094309 TTTCCGGCTGGAACCATGGAGGG + Intronic
1004642757 6:17531629-17531651 TTTCTGGCTGGAACCATGGAAGG - Intronic
1005778832 6:29166178-29166200 GTTCCGGCAGAGACCCGGGTGGG - Intergenic
1006527182 6:34616523-34616545 TTTCAGGCTGGAACCATGGAGGG + Intronic
1006870599 6:37247658-37247680 TTACAGGCATGAACCCGGCAAGG + Intronic
1020382942 7:7566463-7566485 GTTCCGGCAGGAAACAGGCAAGG - Intergenic
1030352980 7:108510218-108510240 TTTCCGGCTGGAACCATGGTGGG + Intronic
1032992777 7:137412304-137412326 TTTGGGGCAGGAATCAGGGAAGG + Intronic
1038052311 8:23825602-23825624 TCTCCTGCAGGCACCCTGGAGGG + Intergenic
1038286807 8:26212606-26212628 TTACAGGCTGGAACCAGGGATGG - Intergenic
1042858716 8:73293605-73293627 TTTCCGGCTGGAACCATGGAGGG - Exonic
1044446219 8:92279991-92280013 TTACCTGCAGGAAGCGGGGAAGG + Intergenic
1053518424 9:38752439-38752461 GTTCCTGCAGGAACCCTGGTTGG + Intergenic
1055696771 9:78893336-78893358 TTTCCTTCAGGAACTCAGGAGGG + Intergenic
1060878573 9:127101408-127101430 TTTCAGGCAGGAACCCTTGCAGG + Intronic
1062562636 9:137148499-137148521 TTTCCTCGTGGAACCCGGGAGGG + Intronic
1185638231 X:1570810-1570832 TTTACGGGAAGAACACGGGAAGG - Intergenic
1193207212 X:78763143-78763165 TTTCTGGCTGGAACCATGGAGGG + Intergenic
1194412461 X:93573802-93573824 TTTCCAGCTGGAACCATGGAGGG + Intergenic
1196391934 X:115216792-115216814 TTTCCAGCTGGAACCATGGAGGG + Intronic
1201240496 Y:11953582-11953604 TTTCCGGCAGGAAGACTGGCAGG + Intergenic