ID: 1113738073

View in Genome Browser
Species Human (GRCh38)
Location 13:112691719-112691741
Sequence CAAGGTCTCCTATTTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113738073_1113738078 7 Left 1113738073 13:112691719-112691741 CCTTCTTTAAATAGGAGACCTTG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1113738078 13:112691749-112691771 ATAGATAGGTTTCTTTTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 245
1113738073_1113738081 10 Left 1113738073 13:112691719-112691741 CCTTCTTTAAATAGGAGACCTTG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1113738081 13:112691752-112691774 GATAGGTTTCTTTTCAGTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 160
1113738073_1113738080 9 Left 1113738073 13:112691719-112691741 CCTTCTTTAAATAGGAGACCTTG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1113738080 13:112691751-112691773 AGATAGGTTTCTTTTCAGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 209
1113738073_1113738079 8 Left 1113738073 13:112691719-112691741 CCTTCTTTAAATAGGAGACCTTG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1113738079 13:112691750-112691772 TAGATAGGTTTCTTTTCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 279
1113738073_1113738075 -7 Left 1113738073 13:112691719-112691741 CCTTCTTTAAATAGGAGACCTTG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1113738075 13:112691735-112691757 GACCTTGGCCAAAGATAGATAGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113738073 Original CRISPR CAAGGTCTCCTATTTAAAGA AGG (reversed) Intronic
901947753 1:12717470-12717492 CAATGGCTACTATTTAAGGAGGG - Intronic
902422191 1:16289703-16289725 AAAAGTCTCCTGTTTAAAGTAGG + Intronic
905956785 1:42003679-42003701 AGAGGTCTCCTTTCTAAAGAAGG + Intronic
910459155 1:87430158-87430180 CAAGGTTTCCTATTCGAAGGAGG + Intergenic
911617642 1:100032412-100032434 CATGGTCTTTTTTTTAAAGAGGG - Intergenic
913447533 1:118965624-118965646 CATGGAGTCTTATTTAAAGAAGG + Intronic
914316450 1:146517074-146517096 CAAGGTTTCCTGTTTGAAGGAGG + Intergenic
914497906 1:148216287-148216309 CAAGGTTTCCTGTTTGAAGGAGG - Intergenic
1063584714 10:7341626-7341648 CAAGCTCTGGTATTTAAAGAGGG - Intronic
1063619558 10:7633580-7633602 CAAGGTCTCATATTTAATTATGG - Intronic
1064114455 10:12566317-12566339 CTCTGTCTCCTATTTCAAGAAGG - Intronic
1065182171 10:23137265-23137287 CAAAGTCTTCTATTTGAAAATGG + Intergenic
1065749462 10:28872375-28872397 CATGGTCATCTATTTAAAAATGG + Intronic
1069560287 10:69424465-69424487 CACAGTCTCATCTTTAAAGAGGG + Intergenic
1070311910 10:75280074-75280096 CAAGGCCTCCTTTGTCAAGATGG + Intergenic
1070675762 10:78410289-78410311 AGAGGTCTCCTCCTTAAAGATGG - Intergenic
1071257521 10:83885264-83885286 GAATGTCTCCTAACTAAAGATGG - Intergenic
1071913998 10:90269856-90269878 CAGGTTCTCCTATTTACAGATGG + Intergenic
1073560220 10:104489884-104489906 CAAGGTTTCATATTTTAATAGGG - Intergenic
1074215860 10:111383069-111383091 GAAGGTCTTCTATTTAGTGATGG - Intergenic
1075357651 10:121796214-121796236 CAAGGGCACCTATTTCAAGAGGG + Intronic
1076428745 10:130387027-130387049 CAATGTTTTCTATTTAAACAAGG - Intergenic
1076449816 10:130549134-130549156 CAGGATTTCGTATTTAAAGACGG + Intergenic
1077122230 11:914916-914938 CAAGGTCTCCTAGTTAGAACAGG - Intronic
1079771488 11:24465505-24465527 CAAGGTATGCTTTTTGAAGAAGG + Intergenic
1080136293 11:28858374-28858396 CAAGGTCTCAGATTGAAATAAGG - Intergenic
1083342334 11:61967052-61967074 CAAGGTCTCCTTAAAAAAGAAGG + Intronic
1085128895 11:74020806-74020828 CTAGTTCTCCTATTCAATGACGG + Intronic
1092438581 12:8475457-8475479 CTAGGTCTCCTACTTCCAGATGG - Intronic
1092760614 12:11807666-11807688 CAACATGTCCTATTTACAGAGGG + Intronic
1093334444 12:17885330-17885352 CATAATCTCCTTTTTAAAGATGG + Intergenic
1095828044 12:46550866-46550888 CTAGGTCTTCTGTTAAAAGATGG + Intergenic
1098440662 12:70513951-70513973 TAAGCTTTCCTATTTAAAGCAGG + Intergenic
1101857419 12:108455573-108455595 CAAGTTCTCCTAATCAAACAAGG + Intergenic
1103118205 12:118356216-118356238 CAAGTTATCCTACTAAAAGAGGG - Intronic
1104510962 12:129377395-129377417 CAAGGTGTCATAATTCAAGATGG + Intronic
1108262913 13:48676167-48676189 CAAGGTCACCTACTTAGAAAAGG + Intronic
1110136288 13:72071403-72071425 CAAGGTCTCCTTTTGAAAATGGG - Intergenic
1111515625 13:89327263-89327285 CCAGGTCTCCAAGTTACAGATGG - Intergenic
1113738073 13:112691719-112691741 CAAGGTCTCCTATTTAAAGAAGG - Intronic
1114879406 14:26765401-26765423 CAAGGTCTCATAACTAATGATGG + Intergenic
1115941281 14:38612729-38612751 AAATGTCTCATATTTCAAGAAGG + Intergenic
1116943516 14:50814221-50814243 CAAGGAATCCTGTTTACAGATGG + Intronic
1117219131 14:53584152-53584174 CAAGGGACCCTTTTTAAAGATGG + Intergenic
1120495329 14:85227456-85227478 CAAGGACTCCTGTTTCAAGCTGG - Intergenic
1120670095 14:87353374-87353396 CAAAGACTCCCAGTTAAAGATGG - Intergenic
1121674474 14:95741230-95741252 CAACATCTCCTATCTACAGAGGG - Intergenic
1125553335 15:40564558-40564580 CTAAGTCTCCTCTTGAAAGAAGG - Intronic
1128464354 15:67897162-67897184 CAAGGTCTCTTGTTTCATGAGGG + Intergenic
1129581578 15:76817231-76817253 CAGGATCTCCTTTTTAAAGGTGG - Intronic
1130392078 15:83465633-83465655 TAAGGTCTCCTTTTAAGAGAGGG + Intronic
1130443754 15:83979602-83979624 CAAGGTTGCCTTTTTCAAGATGG - Intronic
1134584651 16:15399355-15399377 AAAGCTCTCCTATTTTAGGAAGG - Intronic
1135244666 16:20845216-20845238 CAAGGCCTCCTGTTCAAAGGGGG - Exonic
1138866403 16:60826084-60826106 AATGGTCTCCTATTCAAAAATGG + Intergenic
1139075443 16:63441490-63441512 CAAGGAATACTATTTAGAGATGG + Intergenic
1140575952 16:76169127-76169149 ATATGTCTCCTATTTAAAAATGG + Intergenic
1149219563 17:54400915-54400937 AAAGGTCTGCAATTTCAAGATGG + Intergenic
1150018646 17:61587472-61587494 CAAGGGCACCTAGTTAAAGGTGG + Intergenic
1154052169 18:10971419-10971441 CAAGGTCTCCTTGTCTAAGATGG - Intronic
1155608608 18:27636634-27636656 CCAGGTTTTCTATTTCAAGATGG - Intergenic
1156719685 18:40054731-40054753 CAAGGTCTCCAATATAACCAAGG - Intergenic
1158132412 18:54167345-54167367 CAAGGTCGTCTATCTAGAGATGG - Intronic
1158151548 18:54378506-54378528 AAATGTCTAATATTTAAAGATGG + Exonic
1159500424 18:69261873-69261895 CATGTTCACCTATTAAAAGAAGG - Intergenic
1160912867 19:1482896-1482918 CAAGGGCTACTATTTCAACACGG - Exonic
1164550653 19:29209257-29209279 CAAAGTTTCCTTTTTAAAAAAGG + Intronic
928927162 2:36591841-36591863 CCAGGTCTCTCATTTATAGAAGG - Intronic
928964265 2:36961683-36961705 CAAGGGGTCCCTTTTAAAGATGG + Intronic
929868970 2:45741877-45741899 CAGGGTCTCTCCTTTAAAGAGGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930543378 2:52735742-52735764 AGATGTCCCCTATTTAAAGATGG - Intergenic
931096195 2:58943414-58943436 CAATGTCTCCCATTTTAAGTGGG + Intergenic
932133608 2:69209620-69209642 CAATGTCGCCTCTTTAGAGAGGG - Intronic
932617086 2:73239649-73239671 CCAGTTATCCTATTGAAAGAGGG + Exonic
932627360 2:73308329-73308351 CAAGGGCACCTATTTTGAGATGG + Intergenic
935489945 2:103706404-103706426 GAAGATCAACTATTTAAAGATGG + Intergenic
937488233 2:122338390-122338412 CAAGGTCACCTATTTTATAATGG - Intergenic
937935362 2:127239540-127239562 CAATGTCTCCTATTTGAAATGGG + Intergenic
946798442 2:223382778-223382800 CACGGCCTCCTTTTTTAAGAAGG - Intergenic
946930616 2:224666787-224666809 CTGGGTCTCCAATTTACAGATGG - Intergenic
1173527191 20:43742234-43742256 CTAGGTCTCCAGTTTACAGATGG - Intergenic
1173723782 20:45282655-45282677 CAAGAACTTCTAATTAAAGATGG + Intergenic
1174428914 20:50453552-50453574 CAAGGTCACACATTTAATGATGG - Intergenic
1176010508 20:62891224-62891246 CAAGGTTTCCTGTTGAAAGCAGG - Intronic
1176452307 21:6874842-6874864 CAGGGACTCATATTTAATGAGGG + Intergenic
1176830479 21:13739891-13739913 CAGGGACTCATATTTAATGAGGG + Intergenic
1181286231 22:21754378-21754400 CAAGCTCCCCTGTTTTAAGAAGG - Intergenic
1182802078 22:33039708-33039730 AAATGTCACCTTTTTAAAGATGG + Intronic
949508686 3:4749960-4749982 AAAGGCCTCCTCCTTAAAGATGG - Intronic
949537822 3:5009601-5009623 CAAGGTCTCCTTGTTTCAGAGGG + Intergenic
950550893 3:13665304-13665326 CAATGACTCCTCTTTACAGATGG - Intergenic
950863690 3:16172302-16172324 CAATGTCACCTATTTAGTGAAGG - Intergenic
954004564 3:47580435-47580457 CATGGTCCCCTGTTTAGAGAAGG - Exonic
955821852 3:62904876-62904898 CAAGGTTTACTATTTAGAAATGG - Intergenic
957585782 3:82129903-82129925 GAAGGTCTGCTATAAAAAGAAGG - Intergenic
959846033 3:111035141-111035163 AAAGGGATCCTATTTAAAGAAGG + Intergenic
961743981 3:129051783-129051805 CAAAGTCTCCTCCTTCAAGATGG + Intergenic
961937629 3:130602342-130602364 CAAGTGGTCCTATTCAAAGATGG + Intronic
965129642 3:164680596-164680618 GAATCTCTCCTGTTTAAAGATGG - Intergenic
971065191 4:23023560-23023582 CAAGGTGTCCTACTTATAAAAGG - Intergenic
971160451 4:24128267-24128289 TAATGTCTCCATTTTAAAGAAGG - Intergenic
972019897 4:34299498-34299520 CAATGACTACTATTTAAATAAGG + Intergenic
974369269 4:60993374-60993396 CATGGTTTCCTATAGAAAGAAGG + Intergenic
974421034 4:61674836-61674858 AAAGATCTACTATTTTAAGAAGG + Intronic
974750829 4:66138710-66138732 CAAGGGCTCCTTTTGAAAGATGG + Intergenic
975919242 4:79364688-79364710 CAAGCTCCTCTAATTAAAGATGG - Intergenic
976077391 4:81315076-81315098 CAATGCCTTCTATTTGAAGAGGG + Intergenic
976385806 4:84456621-84456643 GAATGTCTCCAATTTAAAAAGGG - Intergenic
982701711 4:158664795-158664817 TAAGGTATCCTATTTAGAGGGGG + Intergenic
983084657 4:163428091-163428113 TAGGGTGTCCTATTTAGAGAGGG + Intergenic
983183916 4:164679511-164679533 CAAGTTTTCATATTTAAACATGG - Intergenic
983880238 4:172924341-172924363 CACTGTCTCCAATTGAAAGAAGG + Intronic
986098375 5:4582624-4582646 CAAAGTCTCTTATATAAACATGG + Intergenic
986592174 5:9382421-9382443 TAAGCACTCCTTTTTAAAGAAGG - Intronic
987253218 5:16121626-16121648 CAAGTTCTTCTAATTACAGAAGG + Intronic
989153047 5:38319107-38319129 CAAGGTCACCTTTCCAAAGAAGG - Intronic
993220849 5:85095350-85095372 CAAGGTCTTCTGTATAAAAAAGG - Intergenic
994445445 5:99866943-99866965 CAAGCTCTCATACTGAAAGATGG - Intergenic
995804579 5:116037184-116037206 GAATCTCTCCTATTTAAAGCAGG - Intronic
1000456758 5:161458991-161459013 CATGGTTTCATATTAAAAGATGG - Intronic
1000502807 5:162073429-162073451 CAAGATCTCCTCTTTAAAAATGG - Intronic
1004818712 6:19341990-19342012 TAAGGTCTCACATTCAAAGAGGG - Intergenic
1011997748 6:93614730-93614752 CAAGAACTCCTATTTTAAGATGG + Intergenic
1012065300 6:94542629-94542651 CAATGGGTCCTATTTAAAGGTGG + Intergenic
1012931240 6:105319293-105319315 CAAGTACTCATATTTTAAGAAGG - Intronic
1015328776 6:131953174-131953196 TAAGAGTTCCTATTTAAAGAAGG + Intergenic
1017676016 6:156814462-156814484 CAAGGTGTCTTATTTAAAAGAGG + Intronic
1017772711 6:157655321-157655343 CAATCTCTCCTACTTAAAAAAGG - Intronic
1019326381 7:440358-440380 CAAGGTCTCCTTTTTACAGTGGG + Intergenic
1020608172 7:10363219-10363241 CAATTTCTCCCATTTAAAGAGGG + Intergenic
1022085184 7:27060501-27060523 CAAAGAATCCAATTTAAAGATGG + Intergenic
1022331970 7:29388387-29388409 GAAGGTCTCCTCTGTATAGAAGG - Intronic
1024234414 7:47387165-47387187 CAAGTTCTGCTATTGAAAGTTGG - Intronic
1030198755 7:106880349-106880371 CAAGGTAGCCTATTTAAAACTGG + Intronic
1032369897 7:131338266-131338288 CAAGATCCCCTAGTGAAAGAAGG - Intronic
1032704872 7:134413149-134413171 CAAGTTCTCCTCTTTAGAAAAGG - Intergenic
1034021495 7:147648279-147648301 CAAGGACACCTGTTTCAAGAAGG + Intronic
1034484525 7:151350405-151350427 CAAGGTCTGCTAAGTAACGAGGG + Intronic
1038766119 8:30429290-30429312 CAGGGGCTCCTGTATAAAGAGGG - Intronic
1039128775 8:34236440-34236462 CAAGCTATCCAATTTAAAAATGG - Intergenic
1041551864 8:59111804-59111826 AAAGGACTCCTAATTAAAGGAGG - Intronic
1042160497 8:65889339-65889361 GAAGGTCTCCTCTCTAAAGGAGG - Intergenic
1043505952 8:80902896-80902918 CAAGTACTTCAATTTAAAGATGG + Intergenic
1044207589 8:89509500-89509522 CAAGCTCTCTTCTGTAAAGAAGG - Intergenic
1044754019 8:95443257-95443279 CAATGTCACCGAGTTAAAGAAGG + Intergenic
1052864007 9:33454041-33454063 CCAGGTCACCCATTTAAAGATGG - Intergenic
1053471236 9:38347233-38347255 CTAGGTCTCCCCTTAAAAGAGGG - Intergenic
1058087013 9:100758785-100758807 CAAAGTCACCTATTAAATGAAGG - Intergenic
1058639220 9:107066929-107066951 CAAGGTCTTCTTTTTAAAGATGG - Intergenic
1059722660 9:116976332-116976354 GAATGTCTCCAATTTACAGAAGG + Intronic
1060234102 9:121850293-121850315 TAGGGTCTCCACTTTAAAGATGG - Intronic
1203516874 Un_GL000213v1:9673-9695 CAGGGACTCATATTTAATGAGGG - Intergenic
1190689007 X:52898045-52898067 CAGGGTCTCATGTTTAGAGAGGG + Exonic
1190696976 X:52957747-52957769 CAGGGTCTCATGTTTAGAGAGGG - Intronic
1193981422 X:88185987-88186009 CAAGTTCTCCCATTTAAAACAGG + Intergenic
1195116700 X:101706488-101706510 CAAGGTTTTTTTTTTAAAGAGGG + Intergenic
1197035682 X:121870629-121870651 CAAGGTCTCCTCTCCAATGAGGG + Intergenic
1198063797 X:133075478-133075500 CCAGTTCTCCTATTTCATGATGG + Intronic