ID: 1113738996

View in Genome Browser
Species Human (GRCh38)
Location 13:112698014-112698036
Sequence TCTTAACTTTAGCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113738996_1113739008 22 Left 1113738996 13:112698014-112698036 CCCTGCCCCTGCTAAAGTTAAGA 0: 1
1: 0
2: 0
3: 7
4: 204
Right 1113739008 13:112698059-112698081 CTCCTCTGATGTGGCTGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 185
1113738996_1113739002 -10 Left 1113738996 13:112698014-112698036 CCCTGCCCCTGCTAAAGTTAAGA 0: 1
1: 0
2: 0
3: 7
4: 204
Right 1113739002 13:112698027-112698049 AAAGTTAAGACTCCTGTGCTGGG 0: 1
1: 1
2: 0
3: 15
4: 198
1113738996_1113739003 -5 Left 1113738996 13:112698014-112698036 CCCTGCCCCTGCTAAAGTTAAGA 0: 1
1: 0
2: 0
3: 7
4: 204
Right 1113739003 13:112698032-112698054 TAAGACTCCTGTGCTGGGACAGG 0: 1
1: 0
2: 1
3: 9
4: 195
1113738996_1113739007 21 Left 1113738996 13:112698014-112698036 CCCTGCCCCTGCTAAAGTTAAGA 0: 1
1: 0
2: 0
3: 7
4: 204
Right 1113739007 13:112698058-112698080 GCTCCTCTGATGTGGCTGCACGG 0: 1
1: 0
2: 2
3: 12
4: 176
1113738996_1113739004 -1 Left 1113738996 13:112698014-112698036 CCCTGCCCCTGCTAAAGTTAAGA 0: 1
1: 0
2: 0
3: 7
4: 204
Right 1113739004 13:112698036-112698058 ACTCCTGTGCTGGGACAGGCAGG 0: 1
1: 1
2: 1
3: 20
4: 245
1113738996_1113739006 13 Left 1113738996 13:112698014-112698036 CCCTGCCCCTGCTAAAGTTAAGA 0: 1
1: 0
2: 0
3: 7
4: 204
Right 1113739006 13:112698050-112698072 ACAGGCAGGCTCCTCTGATGTGG 0: 1
1: 0
2: 1
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113738996 Original CRISPR TCTTAACTTTAGCAGGGGCA GGG (reversed) Intronic
901014714 1:6222037-6222059 TTATAAATTTAGCAGTGGCAGGG - Exonic
904078618 1:27858174-27858196 TTCTACCTTTAACAGGGGCATGG + Intergenic
906495984 1:46304165-46304187 TCCTAACCTGAGCTGGGGCAAGG - Intronic
909470586 1:76023404-76023426 TTTTAAGTTTAGTAAGGGCAGGG + Intergenic
913567641 1:120088730-120088752 TCATATCTTTTGCAGGGACATGG - Intergenic
914288387 1:146249438-146249460 TCATATCTTTTGCAGGGACATGG - Intergenic
914549423 1:148700184-148700206 TCATATCTTTTGCAGGGACATGG - Intergenic
914617258 1:149371534-149371556 TCATATCTTTTGCAGGGACATGG + Intergenic
916245732 1:162686522-162686544 TCATATCCTTTGCAGGGGCATGG - Intronic
917245219 1:172993635-172993657 TCTCAGCTTTGACAGGGGCAGGG - Intergenic
919171922 1:193965364-193965386 TCTAAAGTTTAGCATAGGCAAGG + Intergenic
919220158 1:194617767-194617789 TCTCATCTTTAGCAGAGACAGGG - Intergenic
919501959 1:198348505-198348527 TCTTAACTCTATCAAGGGCCAGG + Intergenic
920097287 1:203494464-203494486 TCTTAATTTTAGCTGGGCAAGGG - Intronic
921678880 1:218008227-218008249 TCTTAACTTTAGCCGAAACAAGG - Intergenic
921737728 1:218647801-218647823 TTTTATCTTTTGCAGGGACATGG - Intergenic
922377936 1:224988206-224988228 TCATATCTTTTGCAGGGACATGG - Intronic
924370109 1:243338796-243338818 TTTAAACTTTGACAGGGGCAAGG - Intronic
1063280371 10:4622535-4622557 TCTTAACTTCAGTAAAGGCATGG - Intergenic
1065928976 10:30462311-30462333 TTTTATTTTTAGCAGGGACAAGG - Intergenic
1066053848 10:31662207-31662229 TCTTATCTTTAGTAGAGACAGGG + Intergenic
1068023246 10:51610727-51610749 TCATATCTTTTGCAGGGACAGGG + Intronic
1068630635 10:59293947-59293969 TCTAAAAGTTAGCAGGGGTAGGG + Intronic
1068645841 10:59466377-59466399 TCATATCTTTAGCAAGGGAAGGG + Intergenic
1070377148 10:75843856-75843878 TCTGAACATTTGCAAGGGCATGG - Intronic
1071700018 10:87921439-87921461 TTTTAATTTTGGCAGAGGCAGGG + Intronic
1073285536 10:102385338-102385360 TCCTAATTTTCCCAGGGGCAGGG - Intergenic
1073369233 10:102971672-102971694 TCTTCATTTTAGCAGCTGCATGG + Intronic
1078753821 11:14190040-14190062 TCTTAGCTTTGGCAGGCGCTGGG + Intronic
1079665701 11:23102930-23102952 TCATATCTTTTGCAGGGACATGG + Intergenic
1080952883 11:37056551-37056573 TCATAACTCTGGCAGGGGAAGGG + Intergenic
1081475923 11:43431077-43431099 TCATAACCTTTGCAGGGACATGG - Intronic
1081736293 11:45406937-45406959 ACTTAAAATTAGCCGGGGCATGG + Intergenic
1083345800 11:61991097-61991119 TCTTATCCTTTGCAGGGACATGG + Intergenic
1085839862 11:79999322-79999344 TCTTTTCCTTTGCAGGGGCATGG + Intergenic
1086055397 11:82640444-82640466 TCTTAACGTTTGCAGGGCAAGGG - Intergenic
1086207679 11:84279644-84279666 TCTCATCTTTTGCAGGGACATGG + Intronic
1086671181 11:89549795-89549817 TCATGTCTTTTGCAGGGGCATGG - Intergenic
1088603905 11:111511112-111511134 TCTTATCTTTGTGAGGGGCACGG - Intronic
1089415516 11:118286166-118286188 TATTAACTTTAGCAGGAGTTCGG + Intergenic
1089970675 11:122690642-122690664 TCTAAACTTTAGCAGCTGCTGGG - Intronic
1090337988 11:125987159-125987181 TTTTAACTTTAGCAAGGGGTTGG - Intronic
1091605213 12:1945719-1945741 TCTTGTCCTTTGCAGGGGCATGG + Intergenic
1094064243 12:26346448-26346470 TTGTAATTTTAGCAGAGGCAGGG - Intronic
1096200981 12:49682778-49682800 TTTTATCTTTTGAAGGGGCAAGG - Intronic
1098279888 12:68851857-68851879 TCATGACTTTAGAAGGGGGAAGG - Exonic
1098903939 12:76142176-76142198 TCTTCACTTCACCAGTGGCAGGG + Intergenic
1099839692 12:87949896-87949918 TCATGTCTTTTGCAGGGGCATGG + Intergenic
1100195480 12:92239791-92239813 TTTTATTTTTAGCAGAGGCAAGG + Intergenic
1100328261 12:93562034-93562056 TCATGACTTTTGCAGGGACATGG + Intergenic
1102398783 12:112610808-112610830 TCTTATCTTTAGTAGAGACAGGG + Intronic
1102500291 12:113347412-113347434 TTTTGACTTCAGCAGGAGCATGG - Intronic
1105369819 13:19792596-19792618 TCGTAATTTTAGCAGAGACAGGG + Intergenic
1108943587 13:55991108-55991130 TCATATCTTTTGCAGGGACATGG - Intergenic
1111599712 13:90456974-90456996 TCCTATCTTTTGCAGGGACATGG + Intergenic
1111843772 13:93483150-93483172 TTTTCATTTTAGCAAGGGCATGG + Intronic
1112148005 13:96723123-96723145 CCTTAATTTTAGCTGGTGCATGG + Intronic
1113215984 13:108041174-108041196 TCATATCTTTTGCAGGGACATGG - Intergenic
1113738996 13:112698014-112698036 TCTTAACTTTAGCAGGGGCAGGG - Intronic
1116161929 14:41278439-41278461 TCATATCTTTTGCAGGGACATGG - Intergenic
1116569480 14:46497306-46497328 TCATGACTTTTGCAGGGACATGG - Intergenic
1119221631 14:72913091-72913113 ATTTAACTTTAGCCTGGGCACGG + Intergenic
1119810007 14:77509278-77509300 GCTTTAACTTAGCAGGGGCATGG - Exonic
1119965272 14:78907947-78907969 TCTTGTCTTTTGCAGGGACATGG - Intronic
1120615559 14:86699516-86699538 TCTGAACTTTTTCAGGGGAAGGG + Intergenic
1124992949 15:34693657-34693679 TCTTCCTTTTGGCAGGGGCAGGG - Intergenic
1125997008 15:44171916-44171938 TCTAAAAATTAGCTGGGGCATGG - Intronic
1127253863 15:57271303-57271325 GCCTAACTTTGGCAGGGGGAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130449598 15:84037418-84037440 GCTTAACTTTTGCAGGGTCATGG - Intronic
1130685816 15:86036550-86036572 TCTGAACTTGAGCAGGAACAAGG + Intergenic
1135998015 16:27268064-27268086 TCATAACTTTAGCTGTGGAAAGG + Intronic
1136246368 16:28978485-28978507 TGTTAACTTTGGCAAGAGCAGGG - Intronic
1136555225 16:31003594-31003616 TCCTAACATTAGCATGGGGAAGG - Intronic
1137523299 16:49211955-49211977 TCTGCACTTTAGCAGGGCTAGGG + Intergenic
1138653736 16:58477752-58477774 TGTTAAAATTAGCAGGGGTAAGG + Intronic
1140286435 16:73606887-73606909 TCTTATCCTTTGCAGGGACATGG - Intergenic
1142185456 16:88692732-88692754 TTGTATCTTTAGTAGGGGCAGGG - Intergenic
1147243686 17:39107121-39107143 TCTTAACCTTGGCAGAGGCCAGG - Intronic
1150828573 17:68498256-68498278 GCTTAACTTGAGCAAGAGCAAGG + Intergenic
1151488269 17:74415910-74415932 TCCTATTTTTAGCAGAGGCAGGG + Intergenic
1151992825 17:77588916-77588938 TCTTATTTTTAGTAGAGGCAGGG - Intergenic
1153137844 18:1937691-1937713 TCATATCCTTTGCAGGGGCATGG - Intergenic
1153362426 18:4212491-4212513 TTTTAACTTTAGTAGAGACATGG - Intronic
1153620565 18:6973785-6973807 TTTTAACTTTATTAGAGGCAGGG + Intronic
1157712462 18:49859379-49859401 TCTTAACTGTGGCGGGGCCATGG - Intronic
1159404723 18:67985289-67985311 TCTTGTCTTTTGCAGGGACATGG - Intergenic
1160667066 19:335879-335901 CCTGTTCTTTAGCAGGGGCAGGG - Intronic
1160814039 19:1027153-1027175 TCTTAGCTTTGGGAGGGGAAGGG + Intronic
1161831614 19:6609205-6609227 GCTTAACTTTAGTGGGTGCAGGG + Intergenic
925762868 2:7203377-7203399 TCTTAACTTTGGGGGGGGGAAGG - Intergenic
926295037 2:11562834-11562856 TCTCAACTTTACCAGTGGCTTGG + Intronic
928132901 2:28666149-28666171 TCATATCTTTTGCAGGGACATGG - Intergenic
928153711 2:28856807-28856829 TTTTATCTTTAGCAGAGACAGGG + Intronic
929190308 2:39133823-39133845 TCCAAAAATTAGCAGGGGCATGG - Intergenic
930119762 2:47750879-47750901 TCGTATCTTTAGCAGAGACAGGG + Intronic
930152039 2:48069104-48069126 TGTTCTCTTTAGCAGGGGAATGG + Intergenic
931933860 2:67173274-67173296 TCTGAACTTTAGCATTGGGAAGG - Intergenic
935835134 2:107042839-107042861 TCATTTCTTTTGCAGGGGCATGG + Intergenic
937361129 2:121230951-121230973 GCTTCACTTCAGCAGGGGCTGGG + Intronic
939027842 2:137034744-137034766 TCATATCTTTTGCAGGGACATGG - Intronic
941727502 2:168879076-168879098 CCTAAACTTTTGCAGGGGGAGGG + Intronic
942268806 2:174253042-174253064 TAATAACTTTAGGAGGGGAAGGG + Intergenic
943191528 2:184684752-184684774 TATTAACTTTAACAGAAGCATGG - Intronic
944535956 2:200710128-200710150 TCTAAATTATAGCTGGGGCAGGG - Intergenic
945202334 2:207295122-207295144 TCTTGTCTTTTGCAGGGACATGG - Intergenic
945352231 2:208794851-208794873 TTTTAAGTTTGTCAGGGGCAAGG + Intronic
945747120 2:213731766-213731788 TCATATCTTTTGCAGGGACATGG - Intronic
946009242 2:216551709-216551731 ACTTAAGTTTCACAGGGGCAGGG + Intronic
946843382 2:223838672-223838694 TCTTAACTTTTGCAGGGTCTAGG - Intergenic
1168987021 20:2058152-2058174 TCATAACCTTTGCAGGGACATGG + Intergenic
1169997766 20:11577723-11577745 TCTTAACTCTAGGCCGGGCACGG + Intergenic
1172098203 20:32470848-32470870 TCTCCCCTTTGGCAGGGGCAGGG - Intronic
1173395697 20:42677601-42677623 TCCTGACTTTAGCTGGGTCACGG - Intronic
1173955819 20:47031800-47031822 TCTGATCATTGGCAGGGGCAGGG + Intronic
1177099669 21:16884613-16884635 TCATATCCTTTGCAGGGGCATGG + Intergenic
1178762384 21:35415633-35415655 TATTAAAATAAGCAGGGGCATGG + Intronic
1180676000 22:17587037-17587059 TCTGAACTGTCCCAGGGGCAGGG + Intronic
1184629076 22:45761954-45761976 TCTTAACTGAAGCAGGTGAATGG + Intronic
949161066 3:882576-882598 TTTTCATTTTAGCTGGGGCAGGG - Intergenic
951938950 3:28055805-28055827 TCTGAACTTGGGCAGTGGCAGGG - Intergenic
953366003 3:42345843-42345865 TCTTACCTTTAGTAGGATCAGGG - Intergenic
954291209 3:49650980-49651002 TCTTTACTTTAGGAGTCGCAGGG - Exonic
954739540 3:52737232-52737254 TTTAAACTTTAGCTTGGGCATGG - Intronic
956190981 3:66608242-66608264 TCTTAAAATGAACAGGGGCATGG - Intergenic
957889058 3:86331304-86331326 TCTTAACTGCAGCAAAGGCAGGG + Intergenic
959691101 3:109199232-109199254 ACTTAAAGTTAGCAAGGGCAGGG - Intergenic
960138794 3:114132242-114132264 TCATATCTTTTGCAGGGACATGG + Intronic
963324327 3:143844920-143844942 TCTTAGCTTTTGCAAGAGCAGGG - Intronic
964333320 3:155627937-155627959 TTGTAATTTTAGCAGAGGCAGGG + Intronic
964390750 3:156195090-156195112 TCATATCTTTTGCAGGGACATGG - Intronic
966529294 3:180956563-180956585 GCTTACTTTTAGCAGGGTCAAGG + Intronic
966657099 3:182371652-182371674 ACTTAAATGTGGCAGGGGCAGGG - Intergenic
967108264 3:186271181-186271203 CCTTAAAATTAGCAGGGGAAGGG - Intronic
967590456 3:191267637-191267659 TATTAAGTTTAGCAAGGGCAGGG + Exonic
970446529 4:16127412-16127434 TCTTAACTGTAGACGGGTCAAGG + Intergenic
970737203 4:19186622-19186644 TTTTAAATTTAGCAGGTGAAAGG - Intergenic
972860269 4:43160020-43160042 TCTTAACTTTAGAAGAAGAAAGG - Intergenic
975148859 4:70999325-70999347 TCATAACCTTTGCAGGGACATGG - Intronic
975904017 4:79188235-79188257 AATTAATTTTATCAGGGGCAGGG + Intergenic
975916306 4:79329790-79329812 TTTTAACATTTGCAGGGACATGG - Intergenic
976926681 4:90506470-90506492 TATTAACTTTAGGCCGGGCATGG + Intronic
978346244 4:107773179-107773201 CCTGAACTTGAGCAGGGCCAAGG - Intergenic
978369511 4:108016370-108016392 TCTTCTCTTTGTCAGGGGCAGGG - Intronic
978669796 4:111232969-111232991 TCCTAACTCTAGCAGGGAGAGGG - Intergenic
979362222 4:119778019-119778041 TCTTGATTTTTGCAGGGACATGG - Intergenic
979402245 4:120262748-120262770 TTTTAACTTTTGCAGGCACATGG - Intergenic
979897299 4:126175637-126175659 TCTCAACTTTTGGAGAGGCAAGG - Intergenic
980548643 4:134303673-134303695 TCATGTCTTTAGCAGGAGCATGG - Intergenic
983160281 4:164405119-164405141 TCTTGACTTTTGCAGGGACATGG + Intergenic
984019233 4:174464986-174465008 TCTTAATTTTAGGAGAGACAAGG + Intergenic
984906505 4:184632053-184632075 TCTTAACCTAACCTGGGGCACGG + Intronic
990152373 5:52833559-52833581 TCTTAACTCTAGCAAGAGCAAGG - Intronic
993460535 5:88176232-88176254 TCATAACCTTTGCAGGGACATGG - Intergenic
993916776 5:93753751-93753773 TCTAAGCTATAGTAGGGGCAAGG + Intronic
995031031 5:107481674-107481696 TGTTATCTTTAGCAGAGACACGG - Intronic
995694108 5:114860484-114860506 TCTTAATTTTAGGATGGGTATGG - Intergenic
996764765 5:127024751-127024773 TCTTACCTTTGGCAGGGGTGGGG + Intronic
997244204 5:132332380-132332402 CCATAACTTTAGGAGGGGGAAGG - Intronic
998860470 5:146438590-146438612 TCTTAATTTTAGTAGAGACAGGG + Intergenic
999078657 5:148822604-148822626 TCATGTCTTTTGCAGGGGCATGG - Intergenic
999969484 5:156845009-156845031 TCTTAACGTTTGCTGGGGAAAGG - Intergenic
1000446110 5:161323193-161323215 TTGTATCTTTAGCAGAGGCATGG + Intronic
1001509924 5:172313020-172313042 TCTAAACTATAGCTGGGGCCAGG - Intergenic
1005834807 6:29700580-29700602 TTGTAACTTTAGTAGAGGCAGGG + Intergenic
1007994611 6:46293028-46293050 TCATAACTTTTGCAGGGACATGG - Intronic
1008368928 6:50712105-50712127 TCTGCACTTTCCCAGGGGCAGGG + Intergenic
1012683254 6:102209852-102209874 TCTTTGCTTTTGCAGGTGCACGG - Intergenic
1012840333 6:104321448-104321470 TCTGAACTTGGGCATGGGCAGGG + Intergenic
1012985077 6:105867123-105867145 TTGTAATTTTAGCAGGGACAAGG - Intergenic
1013026450 6:106278092-106278114 TCTAAACATTAGCCAGGGCATGG - Intronic
1013859860 6:114622784-114622806 TCTTAGCTTTGGCATGGGTATGG + Intergenic
1015533481 6:134244277-134244299 TCTTATCCTTTGCAGGGACATGG - Intronic
1015724450 6:136286204-136286226 TCTTCATTTTAGCAGGCTCAAGG + Intronic
1017492110 6:154953826-154953848 TCTTATTTTTAGCAGAGACAAGG - Intronic
1018603698 6:165575557-165575579 TCTTTACATTAAAAGGGGCAAGG - Intronic
1019081440 6:169433395-169433417 TCTGATCTTTTGCAGGGACATGG - Intergenic
1019413855 7:918658-918680 TCTGAACGTCAGCACGGGCAGGG - Intronic
1020990925 7:15195362-15195384 TGTGCACTTTACCAGGGGCACGG - Intergenic
1022748796 7:33202228-33202250 TCTTAACTTTGGCAGATGCTAGG + Intronic
1022995601 7:35752170-35752192 TCGTAACCTTAGCAGGGAGAGGG - Intergenic
1023136737 7:37060200-37060222 TCTTCACTTTCTCAGGGCCAAGG - Intronic
1023619799 7:42058638-42058660 TATTAACTTTGGAGGGGGCAGGG + Intronic
1026604093 7:71801118-71801140 TCATGTCTTTTGCAGGGGCATGG - Intronic
1027997237 7:85439819-85439841 TCTTATCCTTTGCAGGGACATGG + Intergenic
1028552791 7:92089743-92089765 GCTTAACCTTATCAGGGGAATGG - Intronic
1028579926 7:92398039-92398061 TTTTTCCTTTAGCATGGGCATGG + Intronic
1031655838 7:124353823-124353845 TCTTAACAGTAGCAGTGGCAAGG + Intergenic
1032482153 7:132255879-132255901 TCTTAACTTTTCCAGGTGCTGGG - Intronic
1032561093 7:132893553-132893575 TCTTATATTTGGCAGGGGCCAGG + Intronic
1036551742 8:9821954-9821976 TCATGTCTTTAGCAGGGACATGG + Intergenic
1040649945 8:49436195-49436217 TCTACACTTCTGCAGGGGCATGG - Intergenic
1040784199 8:51146380-51146402 TCATATCTTTTGCAGGGACATGG + Intergenic
1042374488 8:68033621-68033643 TATTCACTTTAGCTAGGGCATGG - Intronic
1045592889 8:103618171-103618193 TCATATCTTTTGCAGGAGCATGG + Intronic
1046156416 8:110295803-110295825 TCATGTCTTTTGCAGGGGCATGG + Intergenic
1046173656 8:110546272-110546294 TCTTAACATTTGTAGGGTCATGG - Intergenic
1046862696 8:119112026-119112048 TCTTGTCTTTTGCAGGGACATGG + Intergenic
1047736877 8:127773583-127773605 TCATATCTTTTGCAGGGACATGG + Intergenic
1051882450 9:21853283-21853305 TCTTAACTTTAGGGGGGAAAAGG + Intronic
1052123271 9:24744230-24744252 TCATATCCTTTGCAGGGGCATGG + Intergenic
1058818231 9:108704987-108705009 TCTTGACTTGAGCAGGGAGATGG + Intergenic
1059050301 9:110917373-110917395 TCTTAAGCTTTTCAGGGGCAGGG + Intronic
1185645149 X:1610560-1610582 TCTTAGCTGGAGTAGGGGCAGGG - Intergenic
1186627870 X:11314598-11314620 TCATATCTTTTGCAGGGACATGG - Intronic
1190530195 X:51367482-51367504 TCATATCTTTTGCAGGGACATGG + Intergenic
1191115942 X:56852951-56852973 TCATGATTTTTGCAGGGGCATGG + Intergenic
1191959180 X:66680757-66680779 TCATGTCTTTTGCAGGGGCATGG - Intergenic
1192784433 X:74323000-74323022 TCTTGTCCTCAGCAGGGGCAAGG - Intergenic
1195970448 X:110467414-110467436 TCATATCTTTTGCAGGGACACGG - Intergenic
1196267084 X:113662686-113662708 TCATATCTTTTGCAGGGACATGG + Intergenic
1199567822 X:149234462-149234484 TCATACCTTTTGCAGGGACATGG + Intergenic