ID: 1113739981

View in Genome Browser
Species Human (GRCh38)
Location 13:112704874-112704896
Sequence TCGTGGGCAATCTGAGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113739981_1113739992 24 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739992 13:112704921-112704943 TCAGCGGGACCCCTGGTGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1113739981_1113739994 29 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739994 13:112704926-112704948 GGGACCCCTGGTGTGGGGGATGG 0: 1
1: 2
2: 10
3: 74
4: 483
1113739981_1113739991 23 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739991 13:112704920-112704942 CTCAGCGGGACCCCTGGTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 108
1113739981_1113739983 -9 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739983 13:112704888-112704910 TGCCCACGAAGACATGGAAATGG 0: 1
1: 0
2: 1
3: 15
4: 182
1113739981_1113739993 25 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739993 13:112704922-112704944 CAGCGGGACCCCTGGTGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 188
1113739981_1113739987 9 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739987 13:112704906-112704928 AATGGCTTTCAGACCTCAGCGGG 0: 1
1: 0
2: 1
3: 10
4: 160
1113739981_1113739995 30 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739995 13:112704927-112704949 GGACCCCTGGTGTGGGGGATGGG 0: 1
1: 1
2: 5
3: 38
4: 274
1113739981_1113739990 22 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739990 13:112704919-112704941 CCTCAGCGGGACCCCTGGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 136
1113739981_1113739988 17 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739988 13:112704914-112704936 TCAGACCTCAGCGGGACCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 147
1113739981_1113739986 8 Left 1113739981 13:112704874-112704896 CCAAGGTCTCAGATTGCCCACGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1113739986 13:112704905-112704927 AAATGGCTTTCAGACCTCAGCGG 0: 1
1: 0
2: 3
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113739981 Original CRISPR TCGTGGGCAATCTGAGACCT TGG (reversed) Intronic
900986207 1:6074031-6074053 GTGTGGGAAATCTGAGTCCTGGG - Intronic
901181054 1:7342170-7342192 CCCTAGGCCATCTGAGACCTGGG - Intronic
901497152 1:9628872-9628894 TCCTGGGGGATCTGAGTCCTCGG - Intergenic
903888239 1:26553605-26553627 TCTTGGGCAATCTGAGGGATGGG + Intronic
903992544 1:27283757-27283779 TCTTGGGCATTGTGTGACCTGGG + Intronic
910288861 1:85581102-85581124 CCGTGGGCAATCTGGGACCAGGG - Intronic
913217715 1:116634531-116634553 TGATGGGCAAACTGAGAACTGGG - Intronic
914347373 1:146811401-146811423 TCTTGGGAAATTTGAGGCCTTGG + Intergenic
915517813 1:156423310-156423332 TTGTGAGCACCCTGAGACCTGGG - Intronic
916551684 1:165855835-165855857 TCCTGGCCAATGTGAAACCTTGG + Intronic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
1071350911 10:84743685-84743707 CAGTGGCCACTCTGAGACCTGGG + Intergenic
1072449917 10:95531719-95531741 TGGTGGGGAAACTGAGACCTGGG - Intronic
1072661379 10:97365664-97365686 TCCCGGGCAATGTGAGACATTGG + Intronic
1077616043 11:3674741-3674763 TATTGGGCAATTTGAGACCCGGG + Intronic
1081874309 11:46398148-46398170 TGGTGGGGAAACTGAGGCCTAGG + Intronic
1091950190 12:4586270-4586292 TCCTGTGCAGTCTAAGACCTGGG - Intronic
1091976194 12:4827500-4827522 TAGTGTGGAATCTGAGACCCAGG - Intronic
1092120877 12:6043022-6043044 AGGTGGGGAATCTCAGACCTGGG - Intronic
1093195361 12:16124154-16124176 ATGTGAGAAATCTGAGACCTTGG + Intergenic
1093739134 12:22661079-22661101 TCCTGGAGAATCTGAGAGCTTGG - Exonic
1095278651 12:40323201-40323223 TCAGGGGCAATCTGAGATATTGG - Exonic
1095375510 12:41523363-41523385 TTGTGGACAATTTGAGACATGGG + Intronic
1095542778 12:43330113-43330135 GTGTGGCCATTCTGAGACCTGGG + Intergenic
1096707153 12:53429521-53429543 TCGTGTGCCATTGGAGACCTGGG + Exonic
1106632095 13:31485341-31485363 ACGTGGTCACTCAGAGACCTAGG + Intergenic
1110255076 13:73424640-73424662 AGGTGGGTACTCTGAGACCTAGG + Intergenic
1113504744 13:110807690-110807712 TGGAGGGGAACCTGAGACCTAGG + Intergenic
1113739981 13:112704874-112704896 TCGTGGGCAATCTGAGACCTTGG - Intronic
1114277621 14:21161716-21161738 TCTTTGGCTATCTGACACCTAGG - Intergenic
1120759565 14:88273536-88273558 TCCTGGGCAATTTGTGCCCTGGG - Intronic
1121888741 14:97569459-97569481 TTCTGGGCAATCTGACCCCTGGG + Intergenic
1124389460 15:29240775-29240797 AGGTAGGGAATCTGAGACCTTGG - Intronic
1125806625 15:42498512-42498534 TCGTGGGCAGCCTCAGAACTTGG - Intronic
1126039781 15:44578633-44578655 TAGTGGTCAATCTGTGACCTTGG - Intronic
1126168607 15:45675229-45675251 TCGTAGGCCATCTAAGACTTGGG - Intronic
1128093251 15:64933300-64933322 TCCTGGGCAAACTGAGACAGTGG + Intronic
1129333586 15:74839813-74839835 AGGTGGGGAATCTGAGACCGAGG + Intronic
1138590144 16:57995329-57995351 TCATGGGCAGCCAGAGACCTAGG + Exonic
1139162626 16:64529558-64529580 TCATGGGGAAGCTGTGACCTTGG + Intergenic
1139986614 16:70903844-70903866 TCTTGGGAAATTTGAGGCCTTGG - Intronic
1141108965 16:81256570-81256592 TCCTGGGCAGTTTGAAACCTCGG - Intronic
1142105197 16:88298927-88298949 TGGTGAGCTCTCTGAGACCTGGG + Intergenic
1144864065 17:18323646-18323668 TCGTGGGAAACATGCGACCTTGG + Intergenic
1147689620 17:42307343-42307365 TCCTGGGCCACCTGTGACCTGGG + Intronic
1153943964 18:10002697-10002719 TCTTGGGCCATGTGAGATCTTGG - Intergenic
1155624497 18:27819133-27819155 ACGTGTGCAAGCTGAGGCCTCGG - Intergenic
1156713346 18:39975679-39975701 TCATGGGCAATGGGAGACCAAGG - Intergenic
1164470850 19:28530578-28530600 TGGTGGTCAATCTGGGACATGGG - Intergenic
928063749 2:28141722-28141744 TCATGGAAAATCTGAGAGCTAGG - Intronic
930422868 2:51176400-51176422 TTGTGGGCACTCTTAGCCCTAGG + Intergenic
930849651 2:55945776-55945798 CTGTGGGAAATCTGAGGCCTGGG + Intergenic
933249408 2:80012147-80012169 TCGTAGGCAATGAGAGCCCTGGG - Intronic
935094409 2:99930632-99930654 TCAAAGGCAATCTGAGACTTGGG + Intronic
937581115 2:123488894-123488916 TCTTGGGCAATCTGTCAACTTGG + Intergenic
939060410 2:137415078-137415100 TCATGGGCAAACTGAGACACAGG + Intronic
948432371 2:237927887-237927909 TCTTGGGCAAACTGGGACTTTGG + Intergenic
1171837002 20:30166383-30166405 TCTGGAGCAATTTGAGACCTAGG - Intergenic
1172274369 20:33671738-33671760 TCCTGGGCAGTCTCAGACCCTGG - Intronic
1172448359 20:35004754-35004776 TCCTGGGCACTCTGAGAACATGG - Intronic
1174200554 20:48803754-48803776 GCGTGGGCAATCAGAGCTCTGGG + Intronic
1175317057 20:58055847-58055869 TCTTGGGCAATCTGCGTCCGAGG - Intergenic
1176021673 20:62965375-62965397 ACGTGGGCAAGCTCAGGCCTGGG - Intronic
1176073259 20:63237539-63237561 TCTTGGGGAAGCAGAGACCTGGG + Intronic
1178255772 21:31051243-31051265 TCGAGTGCAGTGTGAGACCTTGG + Intergenic
1179770520 21:43612010-43612032 CAGTGGCCAGTCTGAGACCTGGG - Intronic
1180819026 22:18812601-18812623 TGATGGGCAAACTGAGAACTGGG - Intergenic
1181205250 22:21247049-21247071 TGATGGGCAAACTGAGAACTGGG - Intergenic
1203221675 22_KI270731v1_random:48366-48388 TGATGGGCAAACTGAGAACTGGG + Intergenic
1203269151 22_KI270734v1_random:38454-38476 TGATGGGCAAACTGAGAACTGGG - Intergenic
951603043 3:24398189-24398211 ATGTGGGCAATCAGAAACCTAGG + Intronic
961741873 3:129038291-129038313 TCCTAGGCAAGCAGAGACCTGGG + Intronic
962878312 3:139552966-139552988 TCTGGGGCAATCTGAGGCCCAGG + Intergenic
963281197 3:143386106-143386128 TGATGGGAGATCTGAGACCTAGG - Intronic
966180123 3:177180717-177180739 TCCAGGGTAATCTGAGATCTTGG - Intronic
967279554 3:187808669-187808691 TGATGGGCTATCTGAGGCCTGGG - Intergenic
968291380 3:197542306-197542328 TCATGGGCATTCTTAGCCCTGGG - Intronic
970492593 4:16590093-16590115 TCATGTGCCACCTGAGACCTAGG + Intronic
990495299 5:56341567-56341589 TCTTCTGCACTCTGAGACCTTGG - Intergenic
993416603 5:87641034-87641056 TAGTGGACAGTCTGGGACCTGGG + Intergenic
993873258 5:93276594-93276616 TCCTGGGCAAACTGGGACATAGG + Intergenic
996845439 5:127894146-127894168 TCGTGGGCATTCTGATTGCTCGG + Intergenic
998402734 5:141856325-141856347 TGGAGGGCACTCTGAGACCTAGG + Intronic
999243732 5:150142152-150142174 TCGTGGGGAAACTGAGGCTTAGG + Intronic
999959559 5:156739759-156739781 TAGTGAGGAATCAGAGACCTGGG + Intronic
1001411871 5:171518021-171518043 TCCTGGGCAAGCTGGGACCTTGG + Intergenic
1002574749 5:180167987-180168009 TAGCGGCCAGTCTGAGACCTGGG + Intronic
1010863672 6:80945266-80945288 TCAGGGACAATCTGAGACTTTGG + Intergenic
1013360530 6:109390088-109390110 TTCTGGGCAGTCTGAGAACTCGG - Intergenic
1022101575 7:27172598-27172620 TCTTGGGCAATCAGGGCCCTGGG - Intronic
1027266312 7:76496961-76496983 TCCTGGGGAAGCTGAGCCCTTGG + Intronic
1027317692 7:76995079-76995101 TCCTGGGGAAGCTGAGCCCTTGG + Intergenic
1027946191 7:84748867-84748889 TTGAGGGCAATCTGAAGCCTAGG - Intergenic
1031605747 7:123764963-123764985 TGCTGGGCAATCTGACACTTTGG - Intergenic
1036794424 8:11744986-11745008 TCATTAGCACTCTGAGACCTGGG + Intronic
1039686507 8:39807695-39807717 ATGTTGGAAATCTGAGACCTGGG - Intronic
1047490880 8:125373719-125373741 ATGTGGGAAATCTGAGGCCTGGG - Intergenic
1048271042 8:133028237-133028259 TCCTGGGTTACCTGAGACCTTGG + Intronic
1048958570 8:139556979-139557001 TCGTGGCTCATCTGAGAGCTGGG + Intergenic
1055433412 9:76268194-76268216 TCAAAGGCAATCTGAGAGCTAGG - Intronic
1057054922 9:91952862-91952884 TCCTGGGATATCTGAGACCTGGG + Intergenic
1058580327 9:106449309-106449331 CCTTGGGGAATCTGAGAACTTGG + Intergenic
1061093782 9:128442399-128442421 GCGTGGGGAATGTGTGACCTTGG + Intergenic
1062288796 9:135785530-135785552 TGGTGGGGAAGCTGAGGCCTGGG + Intronic
1062447971 9:136603668-136603690 TGGTGGGGAAACTGAGGCCTAGG - Intergenic
1186613047 X:11157172-11157194 ACGTGAGCAAACTGAGATCTAGG - Intronic
1189178079 X:38978189-38978211 AAGTGGGCAATCTGAGATATGGG + Intergenic
1189642951 X:43093988-43094010 CAGTGGTCCATCTGAGACCTGGG + Intergenic
1189644069 X:43107256-43107278 ACGTGGCCACTCTGAGACATAGG - Intergenic
1191715830 X:64192883-64192905 CCATGGGCACTCTGAGAGCTGGG + Exonic
1192368509 X:70494985-70495007 TCAGGGGCAAACAGAGACCTGGG + Intronic