ID: 1113742921

View in Genome Browser
Species Human (GRCh38)
Location 13:112723863-112723885
Sequence CTGTCTCGCCCGAAACCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113742915_1113742921 11 Left 1113742915 13:112723829-112723851 CCTGGATGCTCCCAAAGTGTGCA 0: 1
1: 0
2: 3
3: 13
4: 93
Right 1113742921 13:112723863-112723885 CTGTCTCGCCCGAAACCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 38
1113742917_1113742921 1 Left 1113742917 13:112723839-112723861 CCCAAAGTGTGCATATCTGGTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1113742921 13:112723863-112723885 CTGTCTCGCCCGAAACCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 38
1113742918_1113742921 0 Left 1113742918 13:112723840-112723862 CCAAAGTGTGCATATCTGGTCCT 0: 1
1: 0
2: 3
3: 18
4: 111
Right 1113742921 13:112723863-112723885 CTGTCTCGCCCGAAACCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 38
1113742914_1113742921 18 Left 1113742914 13:112723822-112723844 CCAAATGCCTGGATGCTCCCAAA 0: 1
1: 0
2: 4
3: 13
4: 148
Right 1113742921 13:112723863-112723885 CTGTCTCGCCCGAAACCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113742921 Original CRISPR CTGTCTCGCCCGAAACCCGG AGG Intronic
1067713806 10:48671687-48671709 CTGCCTCGCCCGAGCCCCTGCGG - Intergenic
1085405129 11:76257146-76257168 CTGTCTCCCACGAGCCCCGGCGG - Intergenic
1088870459 11:113886204-113886226 CTGCCCCCCCCGCAACCCGGAGG + Intergenic
1113681656 13:112248715-112248737 CTGTCTTTCCACAAACCCGGGGG + Intergenic
1113742921 13:112723863-112723885 CTGTCTCGCCCGAAACCCGGAGG + Intronic
1118293021 14:64542595-64542617 CTGGCTCGACCGAAACCAGATGG + Exonic
1132799912 16:1746904-1746926 TTGCCTCGCCCGACACCCTGCGG - Intronic
1132900894 16:2253740-2253762 CTTTCTAGCCAGAAAACCGGAGG + Exonic
1133916595 16:10114534-10114556 CTGTGTCCCCAGAAACCCGCAGG + Intronic
1135063537 16:19290513-19290535 CTGTCTCAACTGAGACCCGGAGG - Intronic
1137752478 16:50877089-50877111 CTGTCTCCCAGGAAACCCAGTGG + Intergenic
1140662124 16:77198086-77198108 CTGTCTCCTCCGAAACCCCCAGG + Exonic
1142077862 16:88130905-88130927 CTGTCTCTGCCGACACCCCGCGG - Intergenic
1147015541 17:37489318-37489340 CCGTGGCGCCCGAGACCCGGAGG - Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148648219 17:49231146-49231168 CTGTCGCGTCCTAAACCCAGTGG + Intergenic
1151387031 17:73761253-73761275 TTGTCTCCCCCGAAACCCCTGGG + Intergenic
1160833614 19:1114372-1114394 CTGTCTCGCACGCCAGCCGGGGG + Exonic
934897691 2:98132850-98132872 CAGTCTCGCCTGAAACCCTTTGG + Intronic
937183128 2:120013426-120013448 CGGTATCGACCGAAACTCGGCGG - Intronic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175644314 20:60658228-60658250 CTCTCTATCCCGGAACCCGGAGG + Intergenic
1183586342 22:38755436-38755458 CTGTCTGGCACAAAACCCGTAGG + Intronic
956604033 3:71053587-71053609 CTGTCTCCCCCAGAACCCAGGGG - Intronic
970001945 4:11373094-11373116 CTTTCTAGCCAGAAAACCGGAGG - Intergenic
981913542 4:150009509-150009531 CTGTCAAGCCAGAAACCTGGGGG - Intergenic
985129315 4:186724736-186724758 CGGACTCGGCCGAAGCCCGGAGG + Intronic
1016894579 6:149039633-149039655 CTGTCTGGCTCCAAACCCTGTGG + Intronic
1018679663 6:166253454-166253476 CTGTGTCGCCTGGAGCCCGGCGG + Intergenic
1018864198 6:167734796-167734818 CTTCCTCGCCCCAAACCAGGAGG - Intergenic
1019334182 7:475258-475280 CAGTGTCGTCCTAAACCCGGGGG + Intergenic
1019346184 7:531819-531841 CTGTCTCACCCCCAACCCTGTGG - Intergenic
1022545108 7:31179998-31180020 CTCTCTGGACCGAAACCCAGAGG + Intergenic
1034147270 7:148884254-148884276 CGGTCGCGTCCGACACCCGGTGG - Exonic
1042546615 8:69956845-69956867 CTGTCACACCCGGAACCCTGTGG - Intergenic
1053398881 9:37800681-37800703 CTGCGGCGCCCCAAACCCGGCGG + Exonic
1057708109 9:97412251-97412273 CTGTCGCGCCCGGAGCCCGCAGG - Intronic
1060987286 9:127826975-127826997 CTGTCTCTCCCTATACCCTGAGG + Intronic
1189700991 X:43716221-43716243 CTGTCTCACCCCAACCTCGGTGG - Intronic