ID: 1113746760

View in Genome Browser
Species Human (GRCh38)
Location 13:112750499-112750521
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 9, 1: 2, 2: 2, 3: 14, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113746754_1113746760 16 Left 1113746754 13:112750460-112750482 CCTCTTCAGCCTCTCGTGAATTT 0: 11
1: 0
2: 1
3: 24
4: 384
Right 1113746760 13:112750499-112750521 GAGTCTCCATCCTCCCACGTGGG 0: 9
1: 2
2: 2
3: 14
4: 124
1113746755_1113746760 7 Left 1113746755 13:112750469-112750491 CCTCTCGTGAATTTCTGTCTTAG 0: 10
1: 0
2: 0
3: 10
4: 156
Right 1113746760 13:112750499-112750521 GAGTCTCCATCCTCCCACGTGGG 0: 9
1: 2
2: 2
3: 14
4: 124
1113746753_1113746760 17 Left 1113746753 13:112750459-112750481 CCCTCTTCAGCCTCTCGTGAATT 0: 1
1: 3
2: 0
3: 14
4: 193
Right 1113746760 13:112750499-112750521 GAGTCTCCATCCTCCCACGTGGG 0: 9
1: 2
2: 2
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900874968 1:5335683-5335705 AAGTCTCTTTCCTCCCACTTTGG + Intergenic
902341131 1:15784413-15784435 CAGCCTCCTTCCTCCCACTTAGG + Intronic
902575955 1:17377747-17377769 GAGCCCCCATCCTCTCACCTGGG + Intronic
903976498 1:27153843-27153865 CAGTCTCCATCCTGCCACCTTGG - Intronic
905402913 1:37716370-37716392 GAGGCTCCATCCACCCAAGAAGG + Exonic
906055741 1:42915449-42915471 CAGTCTGCAGCCTCCCACCTGGG + Intergenic
906299999 1:44674696-44674718 GAGTCCCCACCCTCTCATGTAGG + Exonic
906639620 1:47433838-47433860 GAGTCTCCCGCCTCCCACCTGGG + Intergenic
912852997 1:113143268-113143290 GAGTCTCCATCATCACATCTAGG + Intergenic
914916922 1:151824663-151824685 GAGTCTCCATCATCACCCTTGGG + Intronic
916713499 1:167432071-167432093 GAGTCTCCCACCTCCCATATTGG + Intronic
918648052 1:186924832-186924854 CAGTCTTGATCCTCCCACCTTGG - Intronic
920032325 1:203044826-203044848 GGGCCTCCAACCTCCCACCTTGG - Intronic
920227200 1:204447359-204447381 GAGTCTCCGTCCTCCTGCTTTGG - Intronic
920882207 1:209890499-209890521 GTGTCTCCATCCTCCTACTTTGG - Intergenic
922722423 1:227905717-227905739 GAGTCTCCTGCCTCCAACGTGGG - Intergenic
923032832 1:230263479-230263501 GAGGCTCCCTCCTCCCAGCTAGG + Intronic
923499549 1:234553418-234553440 GGGTCTGCAGCCTGCCACGTGGG - Intergenic
1067189979 10:44060996-44061018 GAGGCTCCATCCTCTCAGGCAGG - Intergenic
1074856919 10:117480569-117480591 GCATCTCCATCCTCCCTCCTAGG + Intergenic
1075274518 10:121081117-121081139 GAGTCTCCTTCTGCCCAGGTCGG + Intergenic
1075597580 10:123743274-123743296 CTGTCTTCATCCTCCCACGTGGG - Intronic
1076177161 10:128377026-128377048 TGGTCTCCATCCCCCCACTTGGG - Intergenic
1077010053 11:375680-375702 CAGTCTCCAGCCAGCCACGTGGG + Exonic
1077011510 11:381216-381238 GAGTCCCCATCATCCCACTGGGG + Intronic
1077112899 11:869696-869718 GACTCCCCATCCTCCCATGAGGG - Exonic
1077161850 11:1117108-1117130 CAGTCTCCATCCTCCCGGGTGGG - Intergenic
1079553230 11:21727186-21727208 GAGTCCCCCTCCTCCCAGGGAGG - Intergenic
1081341770 11:41936759-41936781 AAGTCTTCTTCCTCCCAGGTTGG - Intergenic
1084450304 11:69232874-69232896 GCCCCTCCATCCTCCCACCTGGG - Intergenic
1084751242 11:71205514-71205536 GACTCTCCGTCCTGGCACGTGGG - Intronic
1084876107 11:72135192-72135214 GAGACTCCACCTTCCCAGGTGGG + Intronic
1084880972 11:72171671-72171693 GAGACTCCACCCTCCCAGGTGGG + Intergenic
1085303687 11:75473351-75473373 GGGCCTCCATCCACCCACGCTGG + Intronic
1089684553 11:120138420-120138442 GAGTCTCCGTCTTCACAAGTGGG + Exonic
1091828488 12:3532957-3532979 CAGTCTCCACCCTCCCACTCTGG - Intronic
1095987158 12:48006073-48006095 GAGTCTCCATGCTCCCATTCAGG + Intergenic
1096345148 12:50839934-50839956 GAGGCTTTATCCTCCCACCTGGG - Intergenic
1113746590 13:112749659-112749681 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746608 13:112749752-112749774 GAATCTCCATCCTCCCACGTGGG + Intronic
1113746627 13:112749845-112749867 GAGTCTCCATCCTCCCATGTGGG + Intronic
1113746647 13:112749939-112749961 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746667 13:112750033-112750055 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746686 13:112750126-112750148 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746705 13:112750219-112750241 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746724 13:112750312-112750334 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746742 13:112750405-112750427 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746760 13:112750499-112750521 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746778 13:112750592-112750614 GAGTCTCCATCCTCCCACGTGGG + Intronic
1118787119 14:69055163-69055185 GAGGCTGCATCCTCACACGTGGG + Exonic
1202859540 14_GL000225v1_random:72698-72720 GTGTCACCCTCCTCCCTCGTGGG - Intergenic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1127363690 15:58267390-58267412 GACTCTCTTTCCTCCCAAGTAGG + Intronic
1130839984 15:87689340-87689362 GAGTCTCCACCCACCCACATTGG + Intergenic
1131237926 15:90713118-90713140 GAGTATCCAGCCTCTCACTTTGG - Intergenic
1131507591 15:93031165-93031187 GCCTCTCCTTCCTCCCACCTGGG + Intergenic
1131658487 15:94486887-94486909 GTGTCTCTTTCCTCCCAGGTAGG - Intergenic
1132855711 16:2043771-2043793 GGGGCTGCATCCTCCCAGGTTGG - Intronic
1133738201 16:8631602-8631624 CAGTCTCCCTCCTCCCAGCTTGG - Intronic
1136585096 16:31179654-31179676 GCGGCTCCAGCCTCCCTCGTCGG - Intergenic
1137407302 16:48199771-48199793 GGGGCTCCATCCTCCCACCTTGG + Intronic
1141457557 16:84153897-84153919 TAGGCTCCACCCTCCCAGGTGGG + Intronic
1141628538 16:85274620-85274642 GGATCCCCAGCCTCCCACGTGGG + Intergenic
1142292270 16:89198621-89198643 GAATCTCCCTCCTCCCTGGTAGG + Intronic
1144358740 17:14470704-14470726 GAGGCCCCATTCTGCCACGTGGG - Intergenic
1144405216 17:14946121-14946143 AAGTCTCCATCCTCCCTAGAAGG + Intergenic
1147431141 17:40371522-40371544 GAGTCTCCCTGCTCCCTCCTGGG - Intergenic
1151326503 17:73383192-73383214 GGCTCTCCATCCTCCCACCATGG + Intronic
1152294825 17:79460784-79460806 AGGTCTGCATCCTCCCACGGTGG - Intronic
1152303176 17:79507117-79507139 GTGTCTCCAGCCTCCCCCGGGGG - Intronic
1152557686 17:81062544-81062566 GAGCCTCCCTGCTCCCTCGTGGG + Intronic
1160156039 18:76434555-76434577 GAGTTTCCTTCCTGCCACGTAGG - Intronic
1160507428 18:79434977-79434999 AAGTCTCCACCCTCCCAGGTGGG + Intronic
1161567781 19:5013061-5013083 GAGCCTCCAGCCTCCCAGCTTGG + Intronic
1163556591 19:17996927-17996949 CTGCCTCCATCCTCCCACGGAGG + Intronic
1163760286 19:19132750-19132772 TTGTCACCATCCTCCCAGGTGGG - Exonic
1164501043 19:28820539-28820561 GAGTCTCCATCCTCACCCAGAGG - Intergenic
1165508271 19:36248983-36249005 TAGGCTCAATCCTCCCACCTTGG - Intergenic
1166273221 19:41731699-41731721 GAGTCTCTATGCTCTCACTTAGG - Intronic
927649977 2:24906607-24906629 GGTTGTTCATCCTCCCACGTGGG - Intronic
928072597 2:28232276-28232298 AACTCCCCTTCCTCCCACGTGGG - Intronic
929783086 2:44970445-44970467 TGGTCTCAATCCTCCCACTTTGG + Intergenic
930953054 2:57167462-57167484 GAGTCTCCATAATCCCATGGGGG + Intergenic
931563412 2:63588580-63588602 GAGACTGCATCCTCCCATGAGGG - Exonic
940932998 2:159458035-159458057 GAGTCTCCAGCCACCCAGGCTGG + Intronic
945259306 2:207829652-207829674 GAGTTTTCATCCTTCCACGAGGG + Intronic
946460396 2:219863575-219863597 GAATCCCCAGCCTCCCAGGTGGG - Intergenic
946703021 2:222431592-222431614 GATGCTTCATCCTCCCATGTTGG - Intronic
1169439625 20:5623221-5623243 GAGTCTCCCTCCTGCCACACAGG - Intergenic
1172664721 20:36591155-36591177 GAGACTCCAGCTCCCCACGTGGG - Exonic
1172713929 20:36949378-36949400 GAGTGACCATCCACCCACCTCGG - Intronic
1175572160 20:60031817-60031839 AAGTTTTCATCCTCCCACTTTGG + Intronic
1178478151 21:32955937-32955959 TTTTCTCCATCCTCCCCCGTCGG + Intergenic
1178506849 21:33169618-33169640 GGTTCTCCATCCACCCACATAGG + Intronic
1181552283 22:23647284-23647306 AAGACTCAATCCTCCCACTTTGG - Intergenic
1182351476 22:29702460-29702482 GTGTCTCCATCCTCCCCAGCAGG + Intergenic
1185030399 22:48439954-48439976 GAGGCTCCATGCTCCCAGCTGGG + Intergenic
954562227 3:51566920-51566942 TTGTCTCCATCCTCCAACCTAGG + Intronic
954638677 3:52085321-52085343 CAGTCCCCATCCTCACACCTAGG + Intronic
956685297 3:71821250-71821272 CACTCTCCATCCTGTCACGTAGG - Intergenic
961269424 3:125677887-125677909 GTGTCACCCTCCTCCCTCGTCGG + Intergenic
961856867 3:129880440-129880462 CAGTGTCCATCCTCCCAGATTGG - Exonic
963430623 3:145197358-145197380 GAGACTCCTTCCTTCCACTTGGG + Intergenic
966926008 3:184645035-184645057 GATTCTCCTGCCTCCCAAGTAGG - Intronic
968560396 4:1277877-1277899 GGGTCTCCATCTGCCCACCTGGG - Intergenic
968828158 4:2914814-2914836 GACTCTCCCTCCTCCCAGGCAGG - Intronic
976125041 4:81824993-81825015 GAAGCTCCATTCTCCCACTTGGG - Intronic
981564205 4:146081186-146081208 CAGTCTCTCTCCTCCCACTTTGG + Intergenic
985628683 5:1003934-1003956 GAGTCGCCATCCTCCCTCGTGGG + Intergenic
988584861 5:32499512-32499534 GACTCCCCATCCACCCACGCAGG + Intergenic
996183761 5:120451614-120451636 GAGGCTCCATCCTGCCAGCTCGG + Intergenic
998001019 5:138626048-138626070 AAGTCATCATCCTCCCACCTCGG - Intronic
998401840 5:141852487-141852509 GAGTCTCCAGCCTCCCAGCCTGG + Intergenic
998667019 5:144308910-144308932 GGGTCTCATTCCTCACACGTGGG + Intronic
999320382 5:150611356-150611378 GAGTCTCCATTCTACCAGGAGGG + Intronic
1006877357 6:37309519-37309541 TAGTCTCCATCCTTCCCTGTGGG + Intronic
1013757492 6:113478973-113478995 TGGTCTCTATCCTCCCACCTTGG - Intergenic
1015045677 6:128773704-128773726 GAGTTTCCATCTTGCCACGCTGG + Intergenic
1017488861 6:154926551-154926573 TAATCTCCATCCTCCCACGTGGG + Intronic
1018365912 6:163119563-163119585 GAGTCTCCATCATCCCGAGATGG - Intronic
1019100779 6:169627601-169627623 GCGTCTCCATCCTCCTCCCTTGG + Intronic
1019973841 7:4563977-4563999 GAGGCTCCTTTCTCCCACTTAGG + Intergenic
1020082791 7:5295758-5295780 GAGCTTCCAGACTCCCACGTGGG + Intronic
1021443303 7:20704304-20704326 TAGACTCAATCCTCCCACCTTGG + Intronic
1022141858 7:27499778-27499800 GAGTCTCCAGCCTCCACAGTGGG - Intergenic
1026460765 7:70613497-70613519 AAGTCTCCCTCCTCCCAGGCTGG + Intronic
1027270392 7:76515502-76515524 CAGTCTCCAGCCTCCCTCGCAGG - Intronic
1033050596 7:138000994-138001016 AAGTCTCCTTCCTCCCTCTTCGG - Intronic
1033414175 7:141147670-141147692 GTGTGCCCATTCTCCCACGTGGG - Intronic
1034816081 7:154173230-154173252 GAGTCTCATTCGTCCCACGCTGG - Intronic
1044159323 8:88893542-88893564 GAGTTTCCCTGCTCCCACGTTGG - Intergenic
1045675506 8:104603399-104603421 GAGTCTCCAGCCTGCCAGCTTGG - Intronic
1049268874 8:141683749-141683771 CAGTGTCCAGGCTCCCACGTTGG - Intergenic
1050175453 9:2865321-2865343 GCCTCTCCATCCTCCCACTCTGG - Intergenic
1053610916 9:39712205-39712227 AAGTCTCCATCCTGCCACTATGG - Intergenic
1053868954 9:42470227-42470249 AAGTCTCCATCCTGCCACTATGG - Intergenic
1054087338 9:60758953-60758975 AAGTCTCCATCCTGCCACTATGG + Intergenic
1054242606 9:62630190-62630212 AAGTCTCCATCCTGCCACTATGG + Intergenic
1054556730 9:66664708-66664730 AAGTCTCCATCCTGCCACTGTGG + Intergenic
1056291086 9:85144537-85144559 GAGTCTCCAGCTTCCCAAGAAGG + Intergenic
1056822519 9:89853663-89853685 GGGTCTCCATTCTTCCAAGTCGG + Intergenic
1057307737 9:93921820-93921842 GCCCCTCCATCCTCCCACGTGGG - Intergenic
1057487215 9:95495006-95495028 GAGTCTCCACCTTCGCACGCAGG + Intronic
1060985477 9:127816834-127816856 GAGACTCCATCCTCCCAGCAAGG + Intronic
1185508458 X:645273-645295 GAGACCCGAACCTCCCACGTTGG + Exonic
1189219727 X:39361233-39361255 GAGTCTCCATACTGCCTCATGGG + Intergenic
1192186782 X:68952387-68952409 GAGCCTCCACCCTCCTCCGTGGG + Intergenic
1192445378 X:71207286-71207308 GATTATCCATCCACCCACCTCGG + Intergenic
1192498929 X:71635896-71635918 TGGTCTCGATCCTCCCACCTTGG + Intergenic
1195850142 X:109273837-109273859 AAGTCTCCATTCTGCCAAGTTGG - Intergenic
1196738813 X:119006424-119006446 GAGTCTCCACTCTCCCACCCAGG + Intronic