ID: 1113747769

View in Genome Browser
Species Human (GRCh38)
Location 13:112756808-112756830
Sequence GCTGGGAGCAGACCCCTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113747769_1113747777 1 Left 1113747769 13:112756808-112756830 CCAGCGAGGGGTCTGCTCCCAGC 0: 1
1: 1
2: 0
3: 21
4: 199
Right 1113747777 13:112756832-112756854 CGGGGCCTGCTCCCAGCGCGGGG 0: 2
1: 1
2: 1
3: 22
4: 190
1113747769_1113747776 0 Left 1113747769 13:112756808-112756830 CCAGCGAGGGGTCTGCTCCCAGC 0: 1
1: 1
2: 0
3: 21
4: 199
Right 1113747776 13:112756831-112756853 ACGGGGCCTGCTCCCAGCGCGGG 0: 2
1: 0
2: 2
3: 14
4: 166
1113747769_1113747781 19 Left 1113747769 13:112756808-112756830 CCAGCGAGGGGTCTGCTCCCAGC 0: 1
1: 1
2: 0
3: 21
4: 199
Right 1113747781 13:112756850-112756872 CGGGGTCTGCTCCCAGCACGTGG 0: 1
1: 2
2: 4
3: 10
4: 146
1113747769_1113747775 -1 Left 1113747769 13:112756808-112756830 CCAGCGAGGGGTCTGCTCCCAGC 0: 1
1: 1
2: 0
3: 21
4: 199
Right 1113747775 13:112756830-112756852 CACGGGGCCTGCTCCCAGCGCGG 0: 2
1: 0
2: 1
3: 24
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113747769 Original CRISPR GCTGGGAGCAGACCCCTCGC TGG (reversed) Intronic
900136269 1:1118391-1118413 TCTGGGAGCAGAGCCCCTGCCGG + Intergenic
900150277 1:1175711-1175733 GCTGGGAGCAGCAGCCTCGCAGG - Intronic
900467169 1:2831443-2831465 GCTGGGAGCAGAATCCTCATGGG - Intergenic
900601913 1:3506340-3506362 GCTGGGAGCAGCCCCCGCCAGGG + Intronic
900633505 1:3651089-3651111 GCGGGGAGCAGACCCGAGGCTGG - Intronic
900782441 1:4626818-4626840 GCTGGGAGCAGCTCCCTCTGGGG + Intergenic
900869763 1:5293625-5293647 TCAGGGAGCAGTCCCCTGGCTGG - Intergenic
903028785 1:20448242-20448264 GAGGGGAGCAGACCCCTGGTCGG - Intergenic
904497492 1:30895430-30895452 TCTGGGAGCTGAGCCCTGGCTGG - Intronic
905278655 1:36835161-36835183 TCTGGGCTCAGACCCCTCTCAGG + Intronic
907335947 1:53699730-53699752 GCTGGGAAGAGACCTCTCACCGG - Intronic
907489169 1:54798061-54798083 GGTGAGGGGAGACCCCTCGCAGG - Intronic
907663462 1:56414520-56414542 GGTGGGAGCAGACCCATTGGGGG - Intergenic
908139983 1:61174220-61174242 GCTGGGAACAGACCCAAGGCAGG - Intronic
908764344 1:67540504-67540526 GCCTGGAGCAGATCCCTCTCCGG + Intergenic
912721642 1:112025297-112025319 GCTGGGAGCAGAACACCCCCAGG + Intergenic
916078325 1:161216138-161216160 GCTGGGAGCTGATCTCTAGCTGG + Intronic
916629215 1:166593718-166593740 TCTGGGAGGAGACCCTTCTCAGG + Intergenic
920313844 1:205064348-205064370 GCGGGGATCAGACGCCTCACGGG - Exonic
920399758 1:205669538-205669560 GCTGGGGGCAGCCCCCACCCCGG + Intronic
920791387 1:209096333-209096355 GCTGGGAGCAGGTCCCTGGCTGG + Intergenic
921277292 1:213532710-213532732 GCTAGGAGCAGGCTCCTTGCCGG + Intergenic
922196064 1:223361905-223361927 GCTGTGACCAGAGCCCTGGCAGG + Intronic
923277037 1:232405512-232405534 GCTGGGGGCAGAATCCTGGCTGG + Intronic
1062936674 10:1395549-1395571 TCAGGGAGCAGACGCCCCGCTGG - Intronic
1064295939 10:14079251-14079273 GCTAAGAGCAGATCCCTGGCAGG - Intronic
1069574415 10:69516655-69516677 GGTGGGTGCTGAGCCCTCGCAGG - Intergenic
1070387593 10:75939849-75939871 GCTGGGAGAAGAGCCTTCCCTGG + Intronic
1071450263 10:85786967-85786989 GCTGGGGGCAGAGCCATGGCTGG + Intronic
1072618193 10:97063433-97063455 GGTGGGTGCAGACCCCTGCCGGG - Exonic
1073379619 10:103067927-103067949 CCACTGAGCAGACCCCTCGCAGG - Intronic
1074048452 10:109860752-109860774 GGTGGGGGCAGCCCCCTCACTGG + Intergenic
1074348924 10:112716032-112716054 GCTGGGAGCGGACCCCTAGAAGG + Intronic
1075120278 10:119659560-119659582 GGTGGGAGCAGAGCCCCCCCGGG + Intronic
1075213177 10:120508992-120509014 GCTGGGAGTTGACCCCTTGTAGG - Intronic
1075400625 10:122159076-122159098 GCAGGGAGCAGACCCCTCCAGGG + Intronic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1076619004 10:131775127-131775149 GCTGGGAGCAGGCCCTGCACGGG - Intergenic
1076754556 10:132562450-132562472 GCTGGGTGCACACTCCTCACAGG - Intronic
1077184924 11:1231659-1231681 CCTGGGGGCAGCCCCCTCCCCGG - Intronic
1077200017 11:1302075-1302097 GCCTGGAGCAGGCCCCTTGCAGG - Intronic
1077488340 11:2849359-2849381 TCTGGGAGCAGGCCCCACCCAGG + Intergenic
1078065152 11:8073798-8073820 GCTGGGAACAGAACCTTCCCCGG + Intronic
1078375860 11:10792604-10792626 GCTGGGAGACCACCCCTGGCAGG - Intergenic
1078890107 11:15547889-15547911 GCTGAGAGGAGAGCCCTCCCCGG - Intergenic
1083629165 11:64086968-64086990 GCAGGGAGATGACCCCTCCCCGG + Intronic
1083936484 11:65872489-65872511 GCTGGGGGCCGACTCCTCACAGG + Intronic
1084619185 11:70257088-70257110 ACTGGGAGCTGCCCCCTAGCAGG - Intergenic
1090777747 11:129980064-129980086 GCTGAGATCAGAGCCCTCACAGG + Intronic
1091823650 12:3493557-3493579 TCTGGGTGCAGACCCCTGCCAGG + Intronic
1095954993 12:47800768-47800790 ACTGTGAGCAGACCCCCAGCAGG + Intronic
1096521405 12:52186746-52186768 GCTGGGCTCAGAGCCCTCCCAGG - Intronic
1103862275 12:124024842-124024864 GCTGGGTGGAGACCCCTCTTGGG + Intronic
1103905502 12:124325478-124325500 GCGGGCAGCGGGCCCCTCGCTGG - Exonic
1106928735 13:34640750-34640772 GGTGAGAGCAGAGCCCTCGAAGG - Intergenic
1109416903 13:62051983-62052005 GCTGGGTACAGACCCCTTTCTGG - Intergenic
1112507427 13:99983217-99983239 GCTGGGCGCAGACCGCCAGCCGG + Intronic
1113506475 13:110820623-110820645 GCTGGAAGCAGAGTCCTCGGTGG - Intergenic
1113747769 13:112756808-112756830 GCTGGGAGCAGACCCCTCGCTGG - Intronic
1113747774 13:112756826-112756848 GCTGGGAGCAGGCCCCGTGCTGG - Intronic
1113747780 13:112756844-112756866 GCTGGGAGCAGACCCCGCGCTGG - Intronic
1113747783 13:112756862-112756884 GCTGGGAGCAGACCACGTGCTGG - Intronic
1113747788 13:112756880-112756902 GCTGGGAGCAGGCCCCGTGCTGG - Intronic
1113747794 13:112756898-112756920 GTTAGGAGCAGGCCCCGCGCTGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1125019410 15:34969899-34969921 GCAGAGAGAAGACACCTCGCTGG + Intergenic
1125457277 15:39872800-39872822 CATGGGAGCAGATCCCTCGTGGG - Intronic
1129600922 15:76997604-76997626 GCTGGGATTAAACCCCTGGCAGG + Intronic
1129712198 15:77826099-77826121 CCTGGGAGCTGACCCCTGCCAGG + Intergenic
1132959236 16:2612904-2612926 GGTGGGAGCAGGACCCTTGCAGG + Intergenic
1132972296 16:2694879-2694901 GGTGGGAGCAGGACCCTTGCAGG + Intronic
1134055669 16:11168391-11168413 AATGGGAGCAGACACCTCGGAGG - Intronic
1135975477 16:27106491-27106513 GCTGGGATCAGAACTCACGCTGG - Intergenic
1137250653 16:46738057-46738079 GCTGGGAGCTGACCCCGCCCAGG - Exonic
1138799790 16:60013397-60013419 GCTGGGAGAATACCCCTCGTTGG - Intergenic
1138883779 16:61050199-61050221 GCTGGGTTCAGAACCCTTGCTGG + Intergenic
1139513615 16:67440931-67440953 GCTGGGGACAGACCCCTAGAGGG - Intronic
1139846903 16:69927700-69927722 GCTGGGAGCAGCCCCTCCCCTGG + Intronic
1140992545 16:80227940-80227962 GCTGGGAGCAGGTGCCTGGCTGG + Intergenic
1141617066 16:85215951-85215973 GCTGTGAGCAGAGCCCTTGGAGG + Intergenic
1143174965 17:4950210-4950232 GCTCGGGGCAGACCCCGCACTGG + Intronic
1143950600 17:10629562-10629584 GCTGGGAGGAGCCCCCCCCCAGG - Intronic
1145199112 17:20924540-20924562 GCAGGGAGCAGGCCCCAGGCTGG + Intergenic
1147140703 17:38459073-38459095 GATGGGAGCAGAGCCCTAGTCGG - Intronic
1152303525 17:79508669-79508691 GCTGTGCACAGCCCCCTCGCTGG + Intronic
1152610786 17:81314161-81314183 GCTGGGAGCAGAGCCCCCACAGG - Intronic
1152705016 17:81838863-81838885 GCTGGGAGCCGACCCCCCTCAGG - Intergenic
1152750371 17:82059814-82059836 GCTGGAAGCAGACACCTGGAGGG - Intronic
1154221759 18:12460947-12460969 GCAGGGAGCAGAGTCCACGCAGG - Intronic
1160014721 18:75131810-75131832 GCTGGCTGCAAACACCTCGCCGG + Intergenic
1160865993 19:1256158-1256180 GCTGGGAGGAGCCCCCGCGACGG - Intronic
1160948888 19:1656257-1656279 GTTGGGATCAGGCCCCTCACTGG - Intergenic
1161357137 19:3825430-3825452 GCTGGGAGCGGCCCTCACGCGGG - Intronic
1161383646 19:3979766-3979788 GCTGGGAGCAGACACCCTGAGGG - Intronic
1162376693 19:10309389-10309411 GCTGGGAGGATCCCCCTCCCAGG - Exonic
1162604342 19:11695152-11695174 GCTGTGACCTGACCCCTCCCAGG + Intergenic
1162683897 19:12365870-12365892 GCTGTGACCTGACCCCTCCCAGG + Intronic
1162802947 19:13120947-13120969 GCTGGGTGCTGACTCCCCGCTGG + Intronic
1164566086 19:29327062-29327084 GCTGGGAGCAGGCCGCATGCTGG + Intergenic
1164575111 19:29401377-29401399 GCTGGGAGCTCACCTCTCACGGG + Intergenic
1165454657 19:35903665-35903687 CCTGGGACCCGCCCCCTCGCAGG + Intronic
1165871482 19:38975998-38976020 GCTAGGACCAGTCCCCCCGCGGG - Intergenic
1167075177 19:47244154-47244176 TCTGGCAGCAGGCCCCACGCAGG + Intergenic
1168098537 19:54128849-54128871 GCTGGGACCGGGCCCCTCTCAGG + Intronic
1168118842 19:54240856-54240878 GCTGGGGGCCGACCACTCGGAGG + Exonic
1168172092 19:54595888-54595910 GCTGGGGGCCGACCACTCGGAGG - Exonic
1168176810 19:54632713-54632735 GCTGGGGGCCGACCACTCGGAGG - Exonic
925445205 2:3921206-3921228 GCTGGGCGCAGAGCCCATGCGGG + Intergenic
926161988 2:10495740-10495762 TCTGGCAGCAGAGCCATCGCCGG - Intergenic
926268054 2:11344289-11344311 CCTGGGAGCAGCCCCCAGGCGGG - Exonic
926740052 2:16103154-16103176 GGTGGGAGCAGAGCCATCACGGG + Intergenic
932567810 2:72920530-72920552 GCTGGGAGCCGAGCCGTCTCGGG + Intronic
932595350 2:73089775-73089797 GCTGGGAGCAGAGCTTTGGCTGG - Intronic
933063481 2:77767692-77767714 GCTGCGAGGAGGCACCTCGCAGG + Intergenic
938492898 2:131775291-131775313 GCTGGGTCCAGACCCCACGTGGG - Intergenic
940112609 2:150171145-150171167 GCTGGGAGCAGTGCTCTCGTCGG + Intergenic
942045344 2:172096492-172096514 GCTGGGCGCAGACCCCCCTCCGG - Intergenic
946179579 2:217941544-217941566 CGTGGGCGCAGACCACTCGCAGG - Intronic
946426660 2:219602020-219602042 GCTGGGAGTAGATGCCTCGGAGG - Exonic
948204932 2:236158665-236158687 GCCAGGAGCAGACGCCTCTCTGG + Intergenic
948862167 2:240757938-240757960 GCTGGGTGCAGACCCCAGACTGG + Intronic
1171337878 20:24402542-24402564 GCTAGCAGAAGACCCCTGGCAGG - Intergenic
1172122050 20:32604210-32604232 GCAGGGATCAGACCCCTCAAGGG - Intronic
1172951587 20:38726260-38726282 TCTGGGAGCAGAGGCCTCCCAGG + Intronic
1174147980 20:48465472-48465494 CCTGGGAGCAGAACCTTCCCTGG - Intergenic
1174173349 20:48630256-48630278 GCTGGGAGCAGCTCCCTCTGAGG - Intronic
1175470226 20:59222298-59222320 GGTGGGTGCGGACCCCTGGCTGG + Intronic
1175495366 20:59410774-59410796 GGTGGGAGAAGACACCTGGCTGG - Intergenic
1175875245 20:62226456-62226478 GCAGGGAGCAGACCCCGAGCGGG - Intergenic
1176046809 20:63097105-63097127 CCTGCGAGCTGACCCCTCGATGG + Intergenic
1176096605 20:63347230-63347252 GCTGAGAGCAGACCGCTCACGGG - Intronic
1176135608 20:63520873-63520895 CCTGGGCGGCGACCCCTCGCGGG - Exonic
1179495730 21:41770156-41770178 GCTGGGTGCAGAGGCCTGGCGGG - Intergenic
1180181943 21:46121962-46121984 GCTGTGAGCAGAGGCCTGGCAGG - Intronic
1181014646 22:20062104-20062126 GCTGGGGACAGACCGCTTGCGGG - Intronic
1182671144 22:31996986-31997008 GCTGAGAGAAGACACCTCCCTGG - Intergenic
1183495766 22:38142945-38142967 GGAGGGTGCAGACCCCTCCCTGG - Intronic
1183655306 22:39181005-39181027 GCTGGGAGCAGACAGCTTGAGGG + Intergenic
1184688786 22:46108229-46108251 GCTGGGAGCAGAGGCCTGCCCGG + Intronic
950465900 3:13153508-13153530 GCTGGGAGCAGCCCCCTTGGTGG - Intergenic
950613934 3:14144493-14144515 GCTGGGATCACACCACTAGCTGG + Intronic
952408587 3:33026806-33026828 GCTGAGAGCTGAACACTCGCTGG + Intronic
953163693 3:40445286-40445308 AGTGGGAGCAGACACTTCGCAGG - Intergenic
953404700 3:42654584-42654606 GCTGGGGGCCGCCCCCGCGCAGG - Intronic
953732962 3:45465595-45465617 GCTGGGAGGAGGCACCTGGCTGG + Intronic
955319463 3:57964004-57964026 GCTGGGAGCTGAGCCCAGGCAGG - Intergenic
959681043 3:109096812-109096834 TCTGGGATCAGACCCCTTTCTGG + Intronic
961006861 3:123411361-123411383 GCAGGGAGCAGACCCCTGACAGG + Intronic
961481295 3:127182798-127182820 GGAGGGAGCAGACCCCTCCCAGG - Intergenic
961487621 3:127227705-127227727 GGAGGGAGCGGACCCCTCCCAGG + Intergenic
962926554 3:139999057-139999079 CCTGGGAGCAGACACATTGCTGG + Intronic
966808837 3:183825920-183825942 GCTGGGAGCAGTCCGCCAGCCGG + Intergenic
968461289 4:726363-726385 GCTGGGAGCAGGCCCTGCGGGGG + Intronic
969231230 4:5833078-5833100 TCTGGGGGCAGACCCCTTCCAGG - Intronic
972486255 4:39543833-39543855 GCTGTCAGCAGACTCGTCGCAGG + Intergenic
972775929 4:42240466-42240488 TCTTGCAGCAGACCCCTGGCTGG + Intergenic
975847664 4:78541864-78541886 GTTGGGAACAGACACCTCCCTGG - Intronic
978394656 4:108265767-108265789 GCTGGAGGCAGACCACTCTCAGG + Intergenic
979585518 4:122410882-122410904 GCTGGGAGCAGAACTCTCTGAGG + Intronic
985168922 4:187127629-187127651 CCTGGGAGCAAAGCCCTCTCGGG - Intergenic
985558687 5:570626-570648 CCCGGGAGCAGACCCCACGGGGG - Intergenic
985558700 5:570679-570701 CCCGGGAGCAGACCCCACGGGGG - Intergenic
985558711 5:570732-570754 CCTGGGTGCAGACCCCACGGGGG - Intergenic
985558723 5:570785-570807 CCTGGGTGCAGACCCCACGGGGG - Intergenic
985558738 5:570857-570879 CCTGGGTGCAGACCCCACGGGGG - Intergenic
985775228 5:1837783-1837805 GCAGGGAGCAAACCACCCGCTGG - Intergenic
997608103 5:135191272-135191294 GCTGCGTGCAGACCCGTCGCGGG - Intronic
997974226 5:138429973-138429995 GCTGGGAGCACAGCCCACCCAGG - Intronic
998151465 5:139759815-139759837 CCTGGGCACAGACCCCTCTCTGG + Intergenic
999234111 5:150080223-150080245 GCTGGAAGCAGGCGTCTCGCTGG - Exonic
1001333307 5:170777513-170777535 GCTGGGGGCAGAGCTCTCTCAGG - Intronic
1001649439 5:173304955-173304977 GCGGGTGGCAGACCCCTCGGAGG + Intergenic
1002576050 5:180174696-180174718 CCTGGGTGCAGGCCCCTCTCTGG + Intronic
1002774090 6:314165-314187 GCAGTGAGCTGACCCCTGGCTGG + Intronic
1004373305 6:15071365-15071387 GCTGGAAGCAGACACCTTGAAGG + Intergenic
1006448118 6:34091154-34091176 CCCGGGAGCAGGCCCCTGGCTGG - Intronic
1007662823 6:43496874-43496896 GATGGGTGCACACCCCTCCCTGG - Intronic
1008007074 6:46422189-46422211 GCTGGCAGGAGAACTCTCGCAGG - Intronic
1008453374 6:51679458-51679480 GCTGGGAACATTCCCCTGGCAGG - Intronic
1016907591 6:149167089-149167111 GCTGCGTGCAGAGCCCTGGCCGG - Intergenic
1019385128 7:750804-750826 GCTGTCAGCAGACCCCTCCCCGG + Intronic
1021373174 7:19875895-19875917 GCTGAGAGCAAACCCCTCAGTGG + Intergenic
1023733481 7:43214785-43214807 GCTGTGAGCTGGCCCCTCTCTGG - Intronic
1023908991 7:44540814-44540836 GCTGGGAGAAGATCCAGCGCTGG - Intronic
1025991847 7:66503209-66503231 GCTGGCAGCGGACCCCTCTAGGG - Intergenic
1026300595 7:69094588-69094610 GGTGGGAGCAGACACATCACAGG + Intergenic
1029436385 7:100566285-100566307 GCTGGAAGTAGACCCCTCCTGGG + Exonic
1029458838 7:100684194-100684216 GCTGGGAGAAGGCCCGGCGCTGG - Intronic
1031919303 7:127589207-127589229 ACTGGGAGCAGACCCCGCGAGGG - Intronic
1034171342 7:149065591-149065613 GCTGGGAGGAGGCGCCTCCCCGG - Intergenic
1035231867 7:157470213-157470235 GCAGGGAGCAGACCCAGTGCCGG - Intergenic
1036656401 8:10679962-10679984 ACAGGGCGCAGACCCCTCTCCGG - Intronic
1038415564 8:27392610-27392632 GCTGGGAGCAGAACACAGGCAGG + Intronic
1040759400 8:50820772-50820794 GCTGGGAGCATACCTCTGACAGG + Intergenic
1045344370 8:101281317-101281339 GATGTGAGCAGACCCCTGGGAGG - Intergenic
1049369979 8:142259756-142259778 GCTGGGAGCAGCCACGTTGCAGG - Intronic
1049745557 8:144261758-144261780 TCTGGGTGCATACTCCTCGCTGG - Exonic
1049831612 8:144704643-144704665 GCTGGCAGCAGGCCCCAGGCTGG - Intergenic
1051567845 9:18520659-18520681 GCTGGGAACAGACACATCCCTGG - Intronic
1057139247 9:92716823-92716845 GGTGGGTGCACACCCCTCCCTGG - Intronic
1059268917 9:113060494-113060516 GCTGGGAACAGAACCTGCGCGGG + Intergenic
1059270053 9:113065943-113065965 GCTGGGAACAGAACCTGCGCGGG + Intergenic
1059271187 9:113071391-113071413 GCTGGGAACAGAACCTGCGCGGG + Intergenic
1059272320 9:113076837-113076859 GCTGGGAACAGAACCTGCGCGGG + Intergenic
1059273455 9:113082279-113082301 GCTGGGAACAGAACCTGCGCGGG + Intergenic
1059274591 9:113087725-113087747 GCTGGGAACAGAACCTGCGCGGG + Intergenic
1060533128 9:124360490-124360512 GCTGGGGGCAGATGCCTCCCTGG - Intronic
1060787698 9:126463665-126463687 GCTGGGAGGTGACCCCTCAGGGG - Intronic
1060972879 9:127748857-127748879 GCGGGGACCAGGCCCCTCTCCGG + Intronic
1061508374 9:131045684-131045706 GCTGGGAGCAGACCCTTGGGAGG - Intronic
1061864359 9:133484897-133484919 GCTGAGGGCAGGCCCCTCCCAGG + Intergenic
1062131160 9:134894005-134894027 GCTGGGTGCACAGCCCTCTCTGG + Intergenic
1062221613 9:135419164-135419186 GCTAGGACCAGGCCCCTCACGGG - Intergenic
1062429628 9:136521246-136521268 GCAGTGAGCACACCCCTCACCGG + Intronic
1062446309 9:136596853-136596875 GCTGAGGGGAGACCCCTCTCTGG + Intergenic
1062642920 9:137530518-137530540 GCAGGAAGCAGAACCCTCGTGGG + Intronic
1062696523 9:137878701-137878723 GCTGGAGGGAGACCCCGCGCAGG - Intronic
1187281452 X:17860960-17860982 CCCGGGAGCAGGCCCCTCCCCGG + Intronic
1197648714 X:129042553-129042575 GCTGGGAGCAGGACCCGGGCTGG + Intergenic
1199971287 X:152863770-152863792 GCTGTGAGTATACCCCTCCCAGG + Intronic
1200114182 X:153762911-153762933 GTTGGGGAGAGACCCCTCGCCGG + Intergenic
1200114942 X:153765876-153765898 GGTGGGAGCAGCCCCTTCTCTGG - Intronic