ID: 1113750715

View in Genome Browser
Species Human (GRCh38)
Location 13:112774920-112774942
Sequence GCTCCCGTGACGGGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 135}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113750715_1113750726 8 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750726 13:112774951-112774973 TGCAAGACCCTGGGGAATGGAGG 0: 1
1: 0
2: 2
3: 28
4: 378
1113750715_1113750731 25 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750731 13:112774968-112774990 TGGAGGCTTTGTTGTTCGGTGGG 0: 1
1: 0
2: 1
3: 4
4: 103
1113750715_1113750730 24 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750730 13:112774967-112774989 ATGGAGGCTTTGTTGTTCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 82
1113750715_1113750724 0 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750724 13:112774943-112774965 CGCAGAGTTGCAAGACCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 91
1113750715_1113750729 21 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750729 13:112774964-112774986 GGAATGGAGGCTTTGTTGTTCGG 0: 1
1: 0
2: 0
3: 18
4: 194
1113750715_1113750723 -1 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750723 13:112774942-112774964 CCGCAGAGTTGCAAGACCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 108
1113750715_1113750721 -2 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750721 13:112774941-112774963 GCCGCAGAGTTGCAAGACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 133
1113750715_1113750725 5 Left 1113750715 13:112774920-112774942 CCACCTTCCCCCGTCACGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1113750725 13:112774948-112774970 AGTTGCAAGACCCTGGGGAATGG 0: 1
1: 0
2: 0
3: 23
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113750715 Original CRISPR GCTCCCGTGACGGGGGAAGG TGG (reversed) Intronic
901157164 1:7148691-7148713 GGTCCCCTGATGGGGGAGGGAGG - Intronic
901441543 1:9281297-9281319 GGTTCCGTGTTGGGGGAAGGAGG + Intergenic
902659965 1:17894149-17894171 ACTCCCGGGACCAGGGAAGGGGG - Intergenic
903446077 1:23423919-23423941 GCCCGCGGGGCGGGGGAAGGGGG - Intronic
906730152 1:48073996-48074018 GAGCCCGAGACGGGGGAAGGGGG - Intergenic
909194642 1:72602199-72602221 CCACCCGTAACTGGGGAAGGTGG - Intergenic
912561578 1:110555347-110555369 GCTCCCTGGCCTGGGGAAGGAGG + Intergenic
913075709 1:115338774-115338796 GCTCCTCTGACAAGGGAAGGCGG + Intergenic
914799391 1:150949379-150949401 GCTTCCGTGACTGGGCAAGCTGG - Exonic
916588147 1:166166054-166166076 GGTCTCGTGGCGGGGGATGGGGG + Exonic
916799237 1:168199909-168199931 GGTTCCGTGAAGAGGGAAGGTGG - Exonic
917329616 1:173868265-173868287 GCTCTGGGGATGGGGGAAGGGGG + Intronic
919786421 1:201261184-201261206 ACTCCAGTGCTGGGGGAAGGGGG - Intergenic
919934426 1:202242081-202242103 GCTCAGGTGACGTGGGAAGGAGG + Intronic
922196350 1:223363619-223363641 GCACCCGGCTCGGGGGAAGGCGG - Exonic
923372415 1:233327548-233327570 GCGCCCGGGACGGGTCAAGGAGG + Intergenic
924565596 1:245195628-245195650 GCTTCAGGGCCGGGGGAAGGAGG + Intronic
1062867259 10:866118-866140 GCTCCAGTGACTGGGGGAGCAGG - Intronic
1066009110 10:31177294-31177316 GCTTCAGTGAAGGGAGAAGGTGG - Intergenic
1070829920 10:79411908-79411930 GCTCCAGGGACTGGGGACGGTGG - Intronic
1073428235 10:103469374-103469396 AATCCCTAGACGGGGGAAGGAGG - Intergenic
1074003327 10:109393712-109393734 GCTCCCTGGGCAGGGGAAGGGGG + Intergenic
1074162211 10:110844507-110844529 GCTCCCCTGCTGGGGGCAGGAGG - Intergenic
1078210368 11:9265229-9265251 GCTGCCGTGACGGGGCGGGGGGG + Exonic
1082785260 11:57313180-57313202 GCTTCAGTGATGGGGGAGGGAGG + Exonic
1083720754 11:64602385-64602407 CCTCCCGGGTCGGGGGAAGGAGG + Intergenic
1083747316 11:64743426-64743448 GCTCCCGGGAGGGGGCGAGGCGG - Intronic
1090635945 11:128690557-128690579 GCTCCCCTCCCGGGGGAAGCAGG + Intronic
1091024076 11:132126529-132126551 CCTCCCATGGCGGGGGCAGGAGG + Intronic
1099793290 12:87363567-87363589 GCTCCCTGGGTGGGGGAAGGAGG - Intergenic
1102492504 12:113297603-113297625 ACTCCCCTGACCTGGGAAGGGGG - Exonic
1104721691 12:131048021-131048043 GCTCCCCTGAAGGGGGTTGGGGG + Intronic
1104889377 12:132132936-132132958 CCTCCCGTGGCTGAGGAAGGAGG - Intergenic
1108274186 13:48791310-48791332 GCAGCTGTGATGGGGGAAGGAGG - Intergenic
1110313547 13:74078847-74078869 TTTCCAGTGACGGGGGTAGGTGG - Intronic
1111638138 13:90931943-90931965 GGGCCCGTGACGGTGGGAGGAGG + Intergenic
1112632652 13:101179609-101179631 GTTCCCCTGATGGGGGATGGAGG - Intronic
1113567143 13:111325998-111326020 CCTCCCGTGTCTGGGGACGGTGG + Intronic
1113750715 13:112774920-112774942 GCTCCCGTGACGGGGGAAGGTGG - Intronic
1113875574 13:113592641-113592663 GCTCCAGTGAATGGGGAAGCAGG + Intronic
1121168717 14:91835935-91835957 GGACCCGTGACCGGGGACGGTGG - Intronic
1122027322 14:98887197-98887219 GGTCCCCTGAGGAGGGAAGGTGG + Intergenic
1122719993 14:103716354-103716376 GCTCCCGAGAAAGTGGAAGGCGG + Intronic
1122895948 14:104757071-104757093 GCTCCTCGGACGGGGGGAGGGGG - Intronic
1122958974 14:105085910-105085932 GCTCCAGTGCCTGGGGCAGGAGG + Intergenic
1126317257 15:47383375-47383397 CCTCCCATGACGAGGGAAGATGG + Intronic
1129221061 15:74131818-74131840 GCTCCTGTGAGGGGAGAAGAAGG - Intronic
1131174433 15:90201249-90201271 GCGCCCGGGAAGGAGGAAGGGGG + Intronic
1132056080 15:98650505-98650527 TCTCCCGGGCCGGGGGATGGAGG + Intronic
1132303279 15:100789556-100789578 GCTCCTGTGAGGAGGGCAGGAGG - Intergenic
1133039556 16:3053075-3053097 GCCTGAGTGACGGGGGAAGGGGG + Intronic
1133043399 16:3072708-3072730 GCCTGAGTGACGGGGGAAGGGGG + Intronic
1133146768 16:3793096-3793118 TCTTCCGTGACAGAGGAAGGAGG + Intronic
1137753845 16:50886183-50886205 GCTCCCCAGAGGAGGGAAGGGGG - Intergenic
1138457857 16:57131688-57131710 GCTCCCATGGCAGGGGGAGGTGG - Intronic
1138844889 16:60553915-60553937 GCTCCCGTGACTATAGAAGGCGG - Intergenic
1143291660 17:5836063-5836085 GCTCCCTTGATGGGGGACTGAGG + Intronic
1143515827 17:7418741-7418763 GCTCCCGAGTTGGGGGGAGGGGG + Exonic
1143693090 17:8587556-8587578 TCTCCAGTGACGGGCCAAGGAGG - Intronic
1145841715 17:28000598-28000620 TCTCCTGGGACTGGGGAAGGTGG - Intergenic
1146063437 17:29618638-29618660 GTTGCAGAGACGGGGGAAGGGGG + Intronic
1147133023 17:38419913-38419935 GCTGCTGTGACTGGGAAAGGAGG - Intergenic
1150391360 17:64791492-64791514 GCTACAGTGACGAGGGAAGTGGG - Intergenic
1153819678 18:8822787-8822809 GCTGCTGTGAACGGGGAAGGTGG - Intronic
1160732867 19:649155-649177 GGTCCCCTGACGGTGGAATGGGG + Intronic
1160834042 19:1116362-1116384 GCTCCCAGGACAGGGGCAGGGGG + Intronic
1162563345 19:11430850-11430872 GTTCCCGTGGCGGTGGATGGTGG - Intronic
1163453090 19:17390659-17390681 ACTGCCGGGAAGGGGGAAGGGGG + Intergenic
1164484404 19:28642473-28642495 GCTCCCCTGATAGGGTAAGGTGG + Intergenic
1164507157 19:28869974-28869996 GCTCCCCTGACAGAGGCAGGTGG - Intergenic
1167643851 19:50695441-50695463 GCCCCCTTGGCGGGAGAAGGGGG + Intronic
1168346830 19:55654023-55654045 GCTCCCGTGAAGGGGGTTGCGGG - Intergenic
928604399 2:32932108-32932130 ACATCCGTGTCGGGGGAAGGGGG - Intergenic
931748563 2:65311559-65311581 GCCTCCGGGTCGGGGGAAGGTGG + Exonic
934544972 2:95207247-95207269 GCTACTGTGAGGGCGGAAGGCGG - Intergenic
937956124 2:127422691-127422713 GCTCCAGGGACGTGGGATGGAGG + Intronic
947097153 2:226578983-226579005 GCCCCTTTGACAGGGGAAGGGGG + Intergenic
947988216 2:234466646-234466668 GCTCCGCTGATGGGGGAGGGTGG + Intergenic
1170885095 20:20333888-20333910 CCTCCCCTGACGAGGGAGGGAGG - Intronic
1171504815 20:25624449-25624471 GATCTGGGGACGGGGGAAGGTGG + Intergenic
1171791802 20:29533321-29533343 GCTCCTCAGACGGCGGAAGGCGG - Intergenic
1172876887 20:38169863-38169885 GCTGCAGGGACGGTGGAAGGGGG - Intergenic
1172891896 20:38271504-38271526 GGTCCCCTGGCGGGGGAAAGAGG - Intronic
1176408273 21:6433707-6433729 GCTCTCGAGGTGGGGGAAGGAGG - Intergenic
1179411748 21:41168060-41168082 GCTCGCGGGAGGGGAGAAGGCGG - Exonic
1179683767 21:43042033-43042055 GCTCTCGAGGTGGGGGAAGGAGG - Intergenic
1180880837 22:19202502-19202524 GGTGCCGTGATGGCGGAAGGAGG - Intronic
1182658236 22:31906507-31906529 GCACCTGTGCTGGGGGAAGGTGG + Exonic
1184297234 22:43532505-43532527 GCTCCCGTGAAGATGGAATGGGG + Intronic
1184961756 22:47934240-47934262 GCTCCTCTGGTGGGGGAAGGTGG - Intergenic
1185023065 22:48391713-48391735 GCTCAAGTGACGAGAGAAGGTGG - Intergenic
949247413 3:1941677-1941699 GCTCCGGTGACAGAGGGAGGAGG + Intergenic
950004839 3:9685031-9685053 GCTCCCTTGACAGGGGCTGGAGG + Intronic
950046668 3:9952245-9952267 GCGCCCGCGACGGGGGCAGCAGG + Intronic
953429151 3:42822876-42822898 GCTTTCATGACTGGGGAAGGGGG - Intronic
954178005 3:48859509-48859531 GCACCCATGACTGGGGAAAGTGG + Intronic
955927555 3:64023040-64023062 GCTGCCCTTACAGGGGAAGGCGG + Intronic
956890034 3:73604179-73604201 GCTGCCGTGAGAGAGGAAGGAGG - Intronic
957041012 3:75335566-75335588 ACTCCCGTGACTGTGGCAGGAGG - Intergenic
958640018 3:96794316-96794338 GCTCCAGTGATGGTGGAAGTGGG + Intergenic
961045818 3:123707221-123707243 ACTCCCGTGACTGTGGCAGGAGG - Intronic
961349613 3:126291584-126291606 GCTCCCTGGAGGAGGGAAGGAGG + Intergenic
963786219 3:149536841-149536863 GCCCCCGTGAAGGGACAAGGGGG + Intronic
966593969 3:181710658-181710680 GCGGCCGGGACTGGGGAAGGGGG - Intergenic
968036210 3:195550194-195550216 GCTCCCGTGGCTGAGGCAGGTGG + Intergenic
968830625 4:2931547-2931569 GCTGCCGTGAAGCGGGTAGGGGG - Exonic
982390342 4:154857003-154857025 GCTCCAGTGACGGATCAAGGTGG + Intergenic
985717903 5:1472958-1472980 GCACCCAGGACAGGGGAAGGAGG - Intronic
985995453 5:3595009-3595031 GCCCCCGCGAAGGGGGAAGACGG - Intergenic
987147730 5:15008790-15008812 GCTGCAGTGATGTGGGAAGGTGG + Intergenic
991521090 5:67496904-67496926 GCTCCTGTGATGGGGGAATGGGG + Intergenic
992614322 5:78534620-78534642 GCTTCAGTGACATGGGAAGGAGG - Intronic
998093914 5:139386569-139386591 CCTCCCTTGACTGGGGATGGGGG - Intergenic
999862998 5:155668529-155668551 GCTCACGTGCCTGGGGCAGGGGG - Intergenic
1002388104 5:178886043-178886065 CCTCCAGTGATGGGTGAAGGAGG + Intronic
1002876541 6:1215752-1215774 GTTCCCGTGCCTGGGGATGGAGG + Intergenic
1003571918 6:7261533-7261555 GATCCCGCGACAGGGGAAGGGGG + Intergenic
1006595719 6:35191591-35191613 GGTCCCATGACGGGGGAGGTAGG + Intergenic
1008885867 6:56431260-56431282 GCTCCCCTGGTGGGGGAGGGGGG - Intergenic
1018702340 6:166436883-166436905 TCTCCCGGGTCAGGGGAAGGCGG - Intronic
1018729832 6:166640472-166640494 GCTCCCCTGATGAGGGGAGGAGG - Intronic
1026621923 7:71957026-71957048 GCTCCCGTGAAGGGAGATGAAGG - Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029458022 7:100680705-100680727 TCTCCAGTGAAGGGGGCAGGAGG - Exonic
1034200896 7:149282282-149282304 GCTCCCGTGGCGGGCGGGGGCGG - Exonic
1034508755 7:151518374-151518396 GCTCCCGTGATTGCGGAACGGGG - Intronic
1037617580 8:20533512-20533534 GCTGCTGTGATGGGGGAAGAAGG - Intergenic
1038035329 8:23682337-23682359 GCTCCTGGGACGGTGGAGGGCGG + Intronic
1049211633 8:141389244-141389266 GGTCCAGTGACTGGGGTAGGTGG + Intergenic
1052886369 9:33652044-33652066 GCTCACTAGACAGGGGAAGGAGG - Intergenic
1052930089 9:34048939-34048961 CCTCGCGTCACGGGCGAAGGAGG + Intronic
1052995982 9:34551861-34551883 CCTCCCCTGAGGGAGGAAGGAGG + Exonic
1054835485 9:69671954-69671976 GCTAGCGAGGCGGGGGAAGGCGG - Intronic
1060666107 9:125433097-125433119 GCTCCCAAGATGGGGGCAGGTGG + Intergenic
1060810311 9:126608259-126608281 GGGCCCGTGTCTGGGGAAGGGGG - Intergenic
1061864504 9:133485418-133485440 GCTGCCGTGTCTTGGGAAGGTGG + Intergenic
1189107976 X:38256404-38256426 GCTCCCAAGCCGGGGGAGGGGGG - Intronic
1190734792 X:53249113-53249135 GCTCCAGTGAAGGGGGATGTTGG - Intronic
1196464709 X:115960265-115960287 GCTCAGGAGAAGGGGGAAGGGGG - Intergenic
1196554321 X:117069738-117069760 GCACCCTGCACGGGGGAAGGGGG + Intergenic
1198215382 X:134550022-134550044 GCTGCCGGGACGGCGCAAGGTGG + Intergenic