ID: 1113751487

View in Genome Browser
Species Human (GRCh38)
Location 13:112779444-112779466
Sequence CTGTCCCAGCTGAAGCACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 612}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113751487 Original CRISPR CTGTCCCAGCTGAAGCACAG CGG (reversed) Intronic
900322381 1:2091476-2091498 CAGTCCCACCTGCAGCACACAGG + Intronic
900484311 1:2914253-2914275 CTGCCCCATCTGGTGCACAGTGG - Intergenic
900959283 1:5909065-5909087 CTGTCCCCCCTTAAGCACAGTGG - Intronic
900976660 1:6021030-6021052 GTCACCCAGCTGAAGTACAGTGG + Intronic
901231227 1:7642600-7642622 CTGGCCCAGCTGAGGCTCTGCGG - Intronic
901509520 1:9709662-9709684 TTGCCCCAGCTGGAGTACAGTGG - Intronic
901707166 1:11082988-11083010 CTGTCCCATCTGTAGTGCAGTGG + Intronic
901724232 1:11228226-11228248 TCGTCCAAGCTGAAGCACGGTGG + Intronic
901740191 1:11336543-11336565 CTGCCTCGGCTGAAGTACAGTGG - Intergenic
902259980 1:15217681-15217703 ATGTCCCAGCTCAAGCAGTGAGG + Intronic
902446655 1:16470252-16470274 ATGTCCCAGCTCAAAGACAGTGG - Intergenic
903199470 1:21722497-21722519 TTGCCCCAGCTGGAGTACAGTGG - Intronic
903300123 1:22372866-22372888 ATATCCAAGCTGTAGCACAGTGG - Intergenic
903602820 1:24554898-24554920 CTGCCCCAGCTGGAGTGCAGTGG - Intergenic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
903930755 1:26861099-26861121 ATGTCCAGGCTGAAGTACAGTGG - Intergenic
903940521 1:26927217-26927239 TTGTCCCAGCTGGAGCACAGTGG + Intronic
903940530 1:26927320-26927342 TTGTCCCAGCTGGAGCACAGTGG + Intronic
904145176 1:28384850-28384872 TTGTCCAGGCTGGAGCACAGAGG - Intronic
904165829 1:28554156-28554178 TTGTCCAAGCTGAAGTACAGTGG - Intronic
904545563 1:31268320-31268342 TTGTCCAAGCTGGAGTACAGTGG + Intronic
904813109 1:33176609-33176631 CTGTGCCAGCTGACGCCCCGAGG - Intronic
904995170 1:34626028-34626050 CTGTCCCAGCTGAAGGTCCCTGG + Intergenic
905264265 1:36740195-36740217 CTCTGGCAGGTGAAGCACAGTGG - Intergenic
905576811 1:39051398-39051420 CTGTCCAGGCTGGAGCACAGTGG + Intergenic
906264296 1:44417121-44417143 CTGTCCCAGCTGCAACCCAGAGG - Intronic
906496808 1:46310500-46310522 TTGTCCAGGCTGAAGTACAGCGG + Intronic
907051845 1:51334926-51334948 CTGGCCCAGCCCCAGCACAGGGG + Intronic
907053056 1:51342729-51342751 AAGTTCCAGCTGAAGCACAAAGG + Intronic
907119509 1:51995997-51996019 TTGCCCCAGCTGGAGTACAGTGG - Intergenic
907425519 1:54376846-54376868 CTGTCCCAACTGAGGCCTAGGGG + Intronic
907496365 1:54847528-54847550 ATGTCCCAGCTTAAGCACTCAGG - Intergenic
909446190 1:75751536-75751558 TCGTCCAAGCTGAAGTACAGTGG + Intronic
910021228 1:82592132-82592154 TTGCCCCAGCTGGAGGACAGTGG + Intergenic
910662233 1:89686218-89686240 CTGTCCCACCTGGAGCACAAAGG + Intronic
911535788 1:99098608-99098630 CTGTCCCAGCAGTTCCACAGGGG - Intergenic
912548379 1:110467410-110467432 CAGTCCCAGCTGAAGGAGACAGG - Intergenic
912565682 1:110585609-110585631 CTGGCCAAGCTGAGGCCCAGGGG + Intergenic
913006129 1:114633398-114633420 TTGCCCAAGCTGGAGCACAGTGG - Intronic
913137867 1:115910269-115910291 TCATCCCAGCTGGAGCACAGTGG - Intergenic
913344874 1:117798337-117798359 CTAGTCCAGCTGAAGGACAGTGG + Intergenic
914200363 1:145479383-145479405 ATGTCCCAGCTCAAAGACAGTGG + Intergenic
914479478 1:148052510-148052532 ATGTCCCAGCTCAAAGACAGTGG + Intergenic
914812810 1:151041557-151041579 CTATCCAAGCTGGAGTACAGTGG - Intronic
914902456 1:151718108-151718130 GTGTCCCAGCTGAGTCCCAGGGG + Intronic
915702550 1:157809882-157809904 TTGCCCCAGCTGAAGTGCAGTGG - Intronic
915852210 1:159336618-159336640 ATGTCCCAGCTCAAGCAGAGGGG - Intergenic
916901794 1:169232956-169232978 GTTGCCCAGCTGGAGCACAGTGG + Intronic
916953946 1:169811613-169811635 TTGTCCAAGCTGGAGTACAGTGG - Intronic
916959753 1:169877193-169877215 TTGCCCCAGCTGGAGTACAGTGG + Intronic
917146216 1:171894284-171894306 CTTTCCCTGCTCAAGGACAGTGG - Intronic
918230220 1:182523073-182523095 GTGTCCCAGCTGGAGTGCAGTGG + Intronic
918317054 1:183331139-183331161 CTCTCCCAGCAAAAGCACAGAGG + Intronic
918364094 1:183788317-183788339 ATGTCCCAGCTCAAGCAGTGAGG + Intronic
918640887 1:186840013-186840035 TTGCCCAGGCTGAAGCACAGTGG + Intronic
919061793 1:192642897-192642919 TTGCCCCAGCTACAGCACAGTGG + Intronic
920413659 1:205783081-205783103 ATGGCCCAGCAGCAGCACAGAGG + Intergenic
920533405 1:206721756-206721778 ATGACCCATTTGAAGCACAGTGG + Intronic
921345528 1:214180381-214180403 CTGTCCCAAATGAAACACAGAGG + Intergenic
921974758 1:221190270-221190292 TTGCCCCAGCTGAAGTGCAGTGG - Intergenic
922039620 1:221883951-221883973 ATGTCCCAGCTCAAACACAGAGG + Intergenic
922340866 1:224654039-224654061 TTGTCCAGGCTGGAGCACAGTGG - Intronic
922502562 1:226108187-226108209 CTGTCCAGGCTGGAGTACAGTGG + Intergenic
923004097 1:230031460-230031482 TTGACCCAGCTGAAGTACAGTGG + Intergenic
923110639 1:230887185-230887207 TTGTCCATGCTGGAGCACAGTGG + Intergenic
923776176 1:236980436-236980458 CTGCCCAGGCTGGAGCACAGTGG - Intergenic
923906845 1:238394476-238394498 GTGTCCCAGCTCAAGCAGTGGGG + Intergenic
923955418 1:239013027-239013049 CTTTTCCAGCTGGAGTACAGGGG + Intergenic
924215330 1:241815158-241815180 ATGTCCCAGTTCAAGCAGAGAGG + Intergenic
924229979 1:241954995-241955017 CTGTCCAGGCTGGAGTACAGTGG - Intergenic
924543398 1:245002562-245002584 TTGCCCGAGCTGAAGTACAGTGG + Intronic
924880193 1:248152548-248152570 CTGTCTCTGCTGCAGCACAGAGG + Intergenic
1062932974 10:1364438-1364460 CTGGCCCAGGTGAGGCACTGCGG + Intronic
1064103946 10:12485489-12485511 CTGTCCCAGGTGGAGGAGAGGGG + Intronic
1064132223 10:12720180-12720202 CTTTTCCATCTGAACCACAGAGG + Intronic
1064402079 10:15029813-15029835 CTGTCCCAGTGGAATCACACAGG - Intergenic
1064724103 10:18259868-18259890 CTGCCCAAGCTGAAGTGCAGTGG - Intronic
1064728548 10:18305926-18305948 CTGTCCAGGCTGGAGTACAGTGG - Intronic
1065047892 10:21760241-21760263 TTGCCCGGGCTGAAGCACAGTGG - Intronic
1065805596 10:29391046-29391068 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
1066351423 10:34640667-34640689 TTGTCCAAGCTGGAGTACAGTGG - Intronic
1067058199 10:43064546-43064568 CTGACCCAGCAGGAGCTCAGGGG + Intergenic
1069064343 10:63926824-63926846 ATGTCCCAGCTCAAGCAGACAGG + Intergenic
1069123208 10:64595489-64595511 ATGTCCCAGCTCAAGCAGATAGG - Intergenic
1069525080 10:69162895-69162917 TTGTCCAAGCTGAAGTGCAGTGG - Intronic
1070079660 10:73173077-73173099 TTGTCCAAGCTGGAGTACAGTGG - Intronic
1070423501 10:76262186-76262208 TTGTCCAGGCTGAAGTACAGTGG - Intronic
1070621192 10:78012668-78012690 CTGACCCAGCAATAGCACAGTGG - Intronic
1071195123 10:83149821-83149843 TTGTCCAGGCTGAAGTACAGTGG - Intergenic
1071231765 10:83596176-83596198 ATGTTCCAGCTCAAGCAGAGAGG - Intergenic
1071575813 10:86725268-86725290 ATCCCACAGCTGAAGCACAGTGG - Intronic
1071732973 10:88267533-88267555 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1072020339 10:91392814-91392836 CTGTCCAGGCTGAAGTACAGTGG - Intergenic
1072381771 10:94879666-94879688 CTGTCCCTGCTGAATCATGGGGG + Intergenic
1073045949 10:100638198-100638220 CTTTCCCAGCCGCAGCTCAGCGG - Intergenic
1073561147 10:104498153-104498175 CTGTCCAAGCTGGAGTGCAGTGG - Intergenic
1074367115 10:112867548-112867570 CTGTGCCAGGTGGAGTACAGTGG - Intergenic
1074607638 10:114989483-114989505 ATGTCTCAGCTCAAGCAGAGAGG - Intergenic
1076004268 10:126935488-126935510 ACGTCCCAGCAGCAGCACAGAGG - Intronic
1077383271 11:2257342-2257364 CTGGGCCAGCAGAACCACAGCGG - Intergenic
1077887260 11:6395271-6395293 CTGTTCCACCTGAAACACATGGG + Exonic
1078195786 11:9135591-9135613 TTGGCCAGGCTGAAGCACAGTGG - Intronic
1078486802 11:11730857-11730879 TTGTCCCAGCTCAAGCAGTGAGG - Intergenic
1078775910 11:14393451-14393473 TTGTCCAGGCTGAAGCGCAGTGG - Intergenic
1078881331 11:15451860-15451882 TAGTCTCAGCTTAAGCACAGAGG + Intergenic
1079063966 11:17273880-17273902 CTGCCCAGGCTGAAACACAGTGG + Intronic
1080176879 11:29374274-29374296 CTGTGTAAGCTGAAGAACAGTGG - Intergenic
1080187746 11:29510441-29510463 CTGTCCAGGCTGGAGCACAATGG - Intergenic
1080479260 11:32629105-32629127 CAATCCCAACTGAAGCAGAGAGG + Intronic
1081014674 11:37861048-37861070 CTCTCCCAGCTGGAGTGCAGTGG - Intergenic
1081667104 11:44923067-44923089 CTGCCCAGGCTGAAGCACAGTGG - Intronic
1082059842 11:47850443-47850465 CTGGCCATGCTGGAGCACAGTGG - Intergenic
1083132689 11:60640648-60640670 ATGCCCAGGCTGAAGCACAGTGG + Intergenic
1083321474 11:61849990-61850012 CTGTCCCCGCTGGAGTGCAGTGG - Intronic
1083536231 11:63468992-63469014 GTGACCCACCTGAAGCCCAGAGG + Intronic
1083988940 11:66234830-66234852 CTGCCCCAGCTGGAGTGCAGTGG - Intronic
1084160628 11:67347565-67347587 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1086202389 11:84219141-84219163 TTGTGCCAGCTAAAACACAGAGG - Intronic
1086362927 11:86077838-86077860 GTCTCCCAGCTGGAGTACAGTGG - Intergenic
1086901374 11:92371675-92371697 TTGTCCAAGCTGGAGCACAGTGG - Intronic
1088274400 11:108069229-108069251 CTGCCCAAGCTGGAGTACAGTGG - Intronic
1088531479 11:110815429-110815451 CTGTCCCTGCTGGAGTACACAGG - Intergenic
1088859684 11:113788269-113788291 CTGTCCCAGCTGGAGTGCAGTGG + Intergenic
1089181026 11:116582926-116582948 CTGTCCCGGCGGAAGAGCAGGGG - Intergenic
1089832190 11:121338462-121338484 CTTTTCCAACTGAGGCACAGCGG - Intergenic
1089904430 11:122023816-122023838 CTGTCCAGGCTGAAGTGCAGTGG - Intergenic
1091570512 12:1681395-1681417 ATATTCCAGTTGAAGCACAGTGG + Intergenic
1091699007 12:2647743-2647765 CAGGGCCAGCTGAAGGACAGAGG - Intronic
1091960291 12:4688443-4688465 CAGTCCAAGCTGAAGTGCAGTGG - Exonic
1093391778 12:18632717-18632739 CTGTCCCAGCTGAAACAGGAAGG + Intronic
1094304907 12:29007918-29007940 ATGTCCCAGCTCAAGCAGTGAGG - Intergenic
1094367543 12:29700086-29700108 CTGCCCAAGCTGGAGTACAGTGG + Intronic
1094477814 12:30854846-30854868 TAGTCCCAGCTGGAGTACAGTGG - Intergenic
1094597940 12:31882515-31882537 TTGCCCCAGCTGGAGTACAGTGG + Intergenic
1094669548 12:32555888-32555910 CTGTTACAGCTGGAGCACAGTGG + Intronic
1095929867 12:47614494-47614516 CTGCCCCAGCTGTGGCTCAGAGG - Intergenic
1096165240 12:49417091-49417113 CTGTCCCTACTGAAGAAAAGAGG - Intronic
1096816665 12:54206034-54206056 CACTCCCAGCTGAAGGCCAGGGG + Intergenic
1097014896 12:55978810-55978832 CTGTCCAGGCTGGAGTACAGTGG + Intronic
1097318789 12:58202590-58202612 ATGTCCCAGCTGAAGCAGTCAGG + Intergenic
1097674096 12:62579202-62579224 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1097679637 12:62636762-62636784 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1097829071 12:64204741-64204763 CTGTCCATGCTGGAGCGCAGTGG - Intronic
1097897738 12:64842317-64842339 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1098078934 12:66762664-66762686 ATTTCCCAGCATAAGCACAGTGG - Intronic
1098343178 12:69472124-69472146 CTGCCCAGGCTGCAGCACAGTGG + Intronic
1099435729 12:82642917-82642939 TTGTCCAAGCTGAAGTGCAGGGG - Intergenic
1100066876 12:90658405-90658427 TTGTCCATGCCGAAGCACAGTGG - Intergenic
1100600544 12:96108630-96108652 CACCCCCAGCTGAATCACAGAGG + Intergenic
1101458500 12:104863393-104863415 TTTCCCCAGCTGAAGCACAGTGG - Intronic
1101849092 12:108388065-108388087 ATGTCCCAGCTCAAGCACTCAGG + Intergenic
1102052729 12:109874797-109874819 CTGCCCAGGCTGAAGTACAGTGG + Intronic
1102203466 12:111074541-111074563 CTGTCCAAGCTGAAGGCCACAGG - Intronic
1103405872 12:120674849-120674871 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
1104416772 12:128602167-128602189 CTGTCCGGGCTGCAGCACACTGG - Intronic
1105212074 13:18262793-18262815 TTGTCCCAGCTGGAGTGCAGTGG + Intergenic
1105268630 13:18847946-18847968 CTGCCCAGGCTGAAGTACAGTGG + Intergenic
1106218569 13:27725110-27725132 CTATCCCAGCTTGAGCACTGGGG - Intergenic
1107164765 13:37271293-37271315 ATGTCCCAGGTCAAGCAGAGAGG - Intergenic
1107511764 13:41092542-41092564 CTGTCCCTGCTGGAGTACAGTGG + Intergenic
1107596573 13:41969223-41969245 CTGCCCCAGCTGAAGCAGCCAGG + Intergenic
1107596994 13:41973445-41973467 CGGTCCCAAGGGAAGCACAGGGG - Intergenic
1108314841 13:49226794-49226816 ATGTCCCAGGTGAAACACAGCGG + Intergenic
1108345169 13:49538674-49538696 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1109347414 13:61131647-61131669 TTGCCCCAGCTGGAGTACAGTGG + Intergenic
1112320906 13:98406727-98406749 CTGTCTCCTCTGTAGCACAGTGG + Intronic
1112749849 13:102571164-102571186 CTGCTTCAGCTGGAGCACAGAGG + Intergenic
1112991139 13:105515154-105515176 TTGTCCAGGCTGAAGTACAGTGG + Intergenic
1113123293 13:106947988-106948010 GTCTCCCAGCTGAAGTGCAGTGG + Intergenic
1113751487 13:112779444-112779466 CTGTCCCAGCTGAAGCACAGCGG - Intronic
1113832966 13:113311444-113311466 CTGCCCCAGTAGAAGCACAAAGG - Intronic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1114542546 14:23472458-23472480 CTGCCCAGGCTGCAGCACAGTGG - Intronic
1114615351 14:24065189-24065211 CTCTCCCTGCTGGAGCCCAGAGG + Exonic
1116978117 14:51138492-51138514 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1117169671 14:53080758-53080780 TTGCCCCAGCTGAAGTGCAGTGG + Intronic
1117458625 14:55922514-55922536 ATGTCCCAGCTCAAGCAAAGAGG + Intergenic
1117685654 14:58250178-58250200 TTGCCCCAGCTGGAGTACAGTGG - Intronic
1117880359 14:60307448-60307470 TTGTCCAAGCTGGAGTACAGTGG + Intergenic
1118018830 14:61689966-61689988 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1118170048 14:63379872-63379894 ATGTCCAAGCTGGAGTACAGTGG + Intronic
1118279274 14:64413867-64413889 TTGCCTCAGCTGCAGCACAGTGG + Intronic
1119698172 14:76730685-76730707 CTGTTCAAGCTGAGACACAGAGG + Intergenic
1119774681 14:77240836-77240858 CTGTCCTTGCTTTAGCACAGAGG + Intronic
1121637487 14:95463570-95463592 CTGTCCCAGCTGGGCCAGAGGGG + Intronic
1121795521 14:96732333-96732355 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1122642525 14:103168529-103168551 CTGCCTCAGTTGGAGCACAGAGG - Intergenic
1122725160 14:103745848-103745870 TTGCCCAGGCTGAAGCACAGTGG + Intronic
1122807918 14:104270031-104270053 GTGTCCCAGCTCAAGCAGCGTGG + Intergenic
1122875519 14:104662544-104662566 GTGTCCCAGCTCAAGCAGCGTGG - Intergenic
1123798142 15:23794328-23794350 CTGGCCCATCTTAAGCCCAGAGG - Intergenic
1124322410 15:28725124-28725146 ATGTCCCAGCACAAGCAAAGAGG + Intronic
1124354751 15:28986536-28986558 TTGTCCAAGCTGAAGTGCAGTGG + Intronic
1124637472 15:31374212-31374234 CAATCCCAGCTGACACACAGTGG - Exonic
1124988123 15:34643263-34643285 TTGTCCATGCTGGAGCACAGTGG + Intergenic
1125186672 15:36938941-36938963 CTGTCCCCGCTGCAGCTCTGTGG + Intronic
1125887506 15:43239632-43239654 CTGCCCAGGCTGGAGCACAGTGG - Intronic
1126806517 15:52354812-52354834 CTGCCCCAGCTGGAGTGCAGTGG - Intronic
1128226991 15:66008782-66008804 TTGTCCAAGCTGGAGCGCAGGGG - Intronic
1128866547 15:71118908-71118930 GTGTCCCAGCCTCAGCACAGCGG - Intronic
1129375260 15:75126294-75126316 CTGTCCCCGCTGGAGCCCTGTGG + Intergenic
1129736437 15:77968159-77968181 TTGCCCCAGCTGGAGTACAGTGG + Intergenic
1129849645 15:78785507-78785529 CTGCTCCAGCTGGAGTACAGTGG - Intronic
1130010122 15:80145532-80145554 CTGTCCAAGCTGGAGTGCAGTGG - Intergenic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1130689418 15:86068012-86068034 TTGTCCAATCTGAAGAACAGAGG + Intergenic
1130851866 15:87802696-87802718 ATGTCCCAGCTCAAGCAGTGAGG - Intergenic
1130866525 15:87937926-87937948 CTGTCCCGGGTGAACCTCAGTGG - Intronic
1132131127 15:99280909-99280931 TTGTCCAAACTGAAGCACATAGG - Intronic
1132146602 15:99433159-99433181 CTGTCCCAGCTCACCCACAGGGG - Intergenic
1132370431 15:101294194-101294216 CCGCCCCAGCTGGAGCGCAGTGG - Intronic
1132468940 16:91038-91060 TTGTCCAGGCTGAAGTACAGTGG - Intronic
1133954280 16:10426890-10426912 TTGTCCAGGCTGAAGTACAGTGG + Intronic
1134134652 16:11670501-11670523 TTGTCCCTGCTGTAGCACACAGG + Intronic
1134671949 16:16062384-16062406 CTGTCCAGGCTGGAGTACAGTGG + Intronic
1135089652 16:19503199-19503221 CTGCCCTAGCTGAGGCACACAGG - Exonic
1135271691 16:21075110-21075132 CAGTCCCGTCAGAAGCACAGGGG - Intronic
1135378273 16:21969909-21969931 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1136690262 16:32023764-32023786 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1136788833 16:32952258-32952280 CTGTCCCAGCTGTAGGGAAGGGG + Intergenic
1136790851 16:32967328-32967350 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1136878964 16:33886604-33886626 CTCTGCCAGCTGAAGGCCAGTGG - Intergenic
1136880979 16:33901676-33901698 CTGTCCCAGCTGTAGGGAAGGGG - Intergenic
1137282784 16:46992504-46992526 CCGTCCCAGCTGCAGGACCGGGG - Intergenic
1137431992 16:48426097-48426119 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1137619451 16:49866927-49866949 CGGTCCCAGCTGCAACACACAGG + Intergenic
1139402377 16:66693284-66693306 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1139451947 16:67035117-67035139 TTGTCCAGGCTGGAGCACAGTGG + Intronic
1139671631 16:68496256-68496278 CTCTCCCAGCTGAAACTCTGTGG - Intergenic
1140459210 16:75125217-75125239 TTGTCCCAGCTGGAGTGCAGTGG - Intergenic
1141042746 16:80685932-80685954 CTCCCCCAGCTGCAACACAGAGG + Intronic
1141124633 16:81392412-81392434 CTATTCCAGCTGAAGGACGGTGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141495343 16:84405878-84405900 TTGTCCAGGCTGGAGCACAGTGG - Intronic
1141664480 16:85458793-85458815 CTATCCCTCCTGCAGCACAGGGG - Intergenic
1203091030 16_KI270728v1_random:1213747-1213769 CTGTCCCAGCTGTAGGGAAGGGG + Intergenic
1203093054 16_KI270728v1_random:1228785-1228807 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1142659122 17:1415521-1415543 TTGTCCCAGCTGGAGTGCAGTGG + Intergenic
1143650687 17:8262754-8262776 TTGTCCAGGCTGAAGTACAGTGG - Intronic
1144793525 17:17875510-17875532 CTGTCCTGGCTGTTGCACAGTGG - Intronic
1144964613 17:19068697-19068719 GTGTCCCAGCTGGAGTGCAGTGG + Intergenic
1144983354 17:19183477-19183499 GTGTCCCAGCTGGAGTGCAGTGG - Intergenic
1144984871 17:19194762-19194784 GTGTCCCAGCTGGAGTGCAGTGG + Intergenic
1145010079 17:19362924-19362946 CCGTCCCCGCCGAAGCGCAGAGG + Intronic
1145188605 17:20818591-20818613 CTGCCCAGGCTGAAGTACAGTGG - Intergenic
1145361085 17:22212960-22212982 TTGCCCAAGCTGAAGTACAGTGG + Intergenic
1145827464 17:27887839-27887861 ATGTCCCAGTTCAAGCACAAAGG + Intronic
1146060546 17:29603576-29603598 CTTTCCAAACTGAAGCACAGAGG - Intronic
1147153117 17:38529899-38529921 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1147408487 17:40231463-40231485 GTGTCCCAGCTGGAGTGCAGTGG + Intronic
1147803315 17:43110546-43110568 TTGTCCCAGCTGGAGTACAGTGG - Intronic
1148007761 17:44447981-44448003 TTGCCCCAGCTGGAGTACAGTGG + Intronic
1148454730 17:47804932-47804954 CAGTCCCATCTGAAGGACTGTGG - Intergenic
1148706465 17:49637905-49637927 CTGCCCCAGCTGGAGTACAGTGG + Intronic
1149214048 17:54333694-54333716 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1149828213 17:59848876-59848898 TTGCCCAAGCTGAAGTACAGTGG + Intergenic
1149832903 17:59887330-59887352 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1150062956 17:62084553-62084575 CTGCCCAGGCTGAAGTACAGTGG - Intergenic
1150088941 17:62302842-62302864 TTGTCCAGGCTGAAGTACAGTGG - Intergenic
1150096895 17:62384573-62384595 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1150268606 17:63847929-63847951 CTGTCCCAGCTGGAGCACCCCGG + Intergenic
1150699292 17:67433669-67433691 CTATCCAGGCTGTAGCACAGTGG - Intronic
1151330322 17:73402641-73402663 CTGTCCAGGCTGGAGTACAGCGG + Intronic
1151383196 17:73739683-73739705 CTGATCCAGCTGAAGCCCAGTGG + Intergenic
1151495365 17:74455068-74455090 CTGTCCGGGCTGAAGGTCAGGGG + Intergenic
1151611738 17:75180668-75180690 TTGCCCAAGCTGAAGTACAGTGG - Intergenic
1151926991 17:77205023-77205045 CTATCCAAAGTGAAGCACAGAGG - Intronic
1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG + Intergenic
1152718057 17:81909308-81909330 CTGTCCCAGCTAAAGAGAAGGGG - Intronic
1153233172 18:2960128-2960150 CTGTCCAGGCTGGAGTACAGCGG - Intronic
1153533264 18:6071349-6071371 GTCTCCCAGCTGAAGTGCAGTGG - Intronic
1153878009 18:9393403-9393425 CTGTCCCAGCTGACACCAAGTGG - Intronic
1154187821 18:12201678-12201700 CTGTCCAGGCTGGAGCGCAGTGG - Intergenic
1154419395 18:14212055-14212077 CTGCCCAGGCTGAAGTACAGTGG - Intergenic
1154971604 18:21415460-21415482 CTGCCCAGGCTGGAGCACAGTGG - Intronic
1155138432 18:23019799-23019821 TTGCCCAGGCTGAAGCACAGTGG + Intronic
1155745815 18:29355638-29355660 CTGGGCCAGCAGATGCACAGAGG + Intergenic
1156328568 18:36097773-36097795 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
1156858339 18:41808953-41808975 TTGTCCATGCTGGAGCACAGTGG + Intergenic
1157503325 18:48206319-48206341 CTTTCCCAGCTGAAATGCAGTGG - Intronic
1158235547 18:55309150-55309172 CTGCCCAGGCTGGAGCACAGTGG + Intronic
1158344039 18:56496874-56496896 CTATCCAAAATGAAGCACAGAGG + Intergenic
1158400486 18:57116989-57117011 CTGGCCCTGCTGAGGGACAGGGG - Intergenic
1158439447 18:57461680-57461702 TTGTTCCAGCTGAAGAACAAGGG + Intronic
1158903716 18:61990127-61990149 TTGCCCAGGCTGAAGCACAGTGG - Intergenic
1159134564 18:64321969-64321991 CTGTCATAGCAAAAGCACAGGGG - Intergenic
1159955888 18:74518220-74518242 TTGTCCAGGCTGGAGCACAGTGG - Intronic
1160018682 18:75163984-75164006 CTCTCCCAGCTGGACAACAGGGG - Intergenic
1160782989 19:886059-886081 GTGTCCCTGCTGAAGCCCAGCGG - Exonic
1161324969 19:3659154-3659176 CTGTCCCCACTCAAGCTCAGGGG + Intronic
1161910453 19:7189701-7189723 TTGTCCAGGCTGAAGTACAGCGG + Intronic
1162447725 19:10733966-10733988 TTGTCCAGGCTGAAGTACAGTGG - Intronic
1162459689 19:10807278-10807300 GTGTCCCAGCTGGAGTGCAGTGG + Intronic
1162766944 19:12925395-12925417 TTGGCCCAGCTGAAGTACAATGG + Intronic
1163265234 19:16216911-16216933 ATGTGCCAGCGGCAGCACAGCGG + Intronic
1163342277 19:16716748-16716770 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
1164739482 19:30565796-30565818 CTGGCCAAGCTGAGGCTCAGAGG - Intronic
1164752524 19:30667294-30667316 CTGTCCCAGTAGCAGAACAGGGG + Intronic
1165176430 19:33933791-33933813 CTGGCTCAGATGATGCACAGAGG - Intergenic
1165190934 19:34062886-34062908 CTGTCTAGGCTGGAGCACAGTGG - Intergenic
1165465285 19:35971000-35971022 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
1165643120 19:37407202-37407224 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
1165737817 19:38188223-38188245 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1165961902 19:39541746-39541768 TTGCCCAAGCTGAAGTACAGTGG + Intergenic
1166659724 19:44638518-44638540 CTGCCCAGGCTGAAGTACAGTGG - Intergenic
1166771622 19:45286671-45286693 TTGCCCAAGCTGAAGTACAGTGG - Intronic
1167303027 19:48690428-48690450 TTGCCCAAGCTGAAGTACAGTGG + Intergenic
1167349799 19:48967467-48967489 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1167785513 19:51632616-51632638 TTGTCCCAGCTGGAGTACAGTGG + Intronic
1167855544 19:52235690-52235712 TTGCCCAAGCTGAAGTACAGTGG - Intergenic
1168116732 19:54225128-54225150 TTGTCCCAGCTGAAGTACAGGGG - Intronic
1168323671 19:55525953-55525975 CTGTCATGGGTGAAGCACAGGGG - Intergenic
1168432470 19:56292321-56292343 TTGTCCAGGCTGGAGCACAGTGG + Intronic
1168443064 19:56388670-56388692 TTGCCCCAGCTGGAGCGCAGTGG + Intronic
924969591 2:113439-113461 CTGTCGCAGCTGAAGAACAAGGG - Intergenic
925627196 2:5853025-5853047 ATGTCCCAGCTGAAGCTGAGAGG - Intergenic
925658178 2:6172319-6172341 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
926191325 2:10730153-10730175 TTGCCCCAGCTGGAGTACAGTGG + Intronic
926191588 2:10732296-10732318 CTGCCCAGGCTGAAGCGCAGTGG + Intronic
927146557 2:20169972-20169994 CTGCCCCAGCTGAAGCCAAGTGG - Intergenic
927201782 2:20582710-20582732 ATGTCCCAACTGAGGGACAGTGG + Intronic
927781886 2:25946224-25946246 CTTTCCCTGCTCAAGGACAGTGG + Intronic
927817830 2:26235267-26235289 CTGTCCAGGCTGGAGTACAGTGG - Intronic
928193527 2:29195693-29195715 CTGCCCGGGCTGGAGCACAGTGG - Intronic
928275554 2:29897299-29897321 CTGTCCAGGCTGGAGTACAGTGG - Intronic
928545029 2:32321736-32321758 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
929413110 2:41719505-41719527 CTGTCCAGGCTGGAGTACAGTGG - Intergenic
929527559 2:42720220-42720242 CTGTCCAAGCTGGAGTGCAGTGG + Intronic
930244236 2:48967133-48967155 CTGCCCAGGCTGAAGTACAGTGG + Intronic
930643741 2:53881623-53881645 GTCTCCCAGCTGGAGCACAGTGG + Intronic
930658760 2:54033235-54033257 TTGTCCAGGCTGGAGCACAGTGG + Intronic
930884986 2:56315047-56315069 CTGTGACAGATGAAGCAAAGGGG - Intronic
930985084 2:57575899-57575921 ATGTCCCAGGTGCAACACAGTGG + Intergenic
931256029 2:60573677-60573699 CTGATGTAGCTGAAGCACAGTGG + Intergenic
931383958 2:61779618-61779640 ATGCCCCAGCTGAAGTGCAGTGG - Intergenic
931446811 2:62333720-62333742 CAGTCCCAGATGAACCACAAAGG + Intergenic
933653993 2:84872458-84872480 TTGCCCAGGCTGAAGCACAGTGG - Intronic
933799234 2:85946675-85946697 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
933946116 2:87287469-87287491 CTATCCCAAATGAAGCATAGAGG - Intergenic
934862695 2:97777773-97777795 TTGTCCAAGCTGGGGCACAGTGG - Intronic
935090241 2:99889166-99889188 CTGTCCAGGCTGGAGTACAGTGG + Intronic
935258207 2:101331293-101331315 CTGCCACATCTTAAGCACAGAGG - Intergenic
935362682 2:102260822-102260844 CTGTCCCAGTTGGAGTGCAGTGG - Intergenic
935936705 2:108193077-108193099 CTGCCCCAGCTGGAGTGCAGTGG - Intergenic
936334094 2:111574105-111574127 CTATCCCAAATGAAGCATAGAGG + Intergenic
936608005 2:113976786-113976808 CTGCCTCAGCTGAAGAGCAGAGG - Intergenic
937345394 2:121122488-121122510 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
937613563 2:123893128-123893150 ATGTACCAGCTCAACCACAGTGG - Intergenic
937880103 2:126858429-126858451 CTCTGGCTGCTGAAGCACAGAGG + Intergenic
940229788 2:151438436-151438458 CTGTCCAGGCTGGAGTACAGTGG - Intronic
940513274 2:154647208-154647230 CTGCCCAAGCTCAAGGACAGGGG - Intergenic
940611217 2:155994134-155994156 CTGCCCAAGCTGAAGTGCAGTGG - Intergenic
941775101 2:169384907-169384929 TTGTCCAGGCTGAAGTACAGTGG + Intergenic
941968593 2:171325223-171325245 CTGCCCAGGCTGGAGCACAGTGG + Intronic
942570924 2:177313477-177313499 CTGTCCAGGCTGGAGTACAGTGG + Intronic
943229866 2:185235137-185235159 TTGCCCCAGCTGGAGTACAGTGG - Intergenic
943399724 2:187392741-187392763 CTGCCCCAGCTGAAGTGCAGTGG + Intronic
943698560 2:190963693-190963715 CTTTCCCAGCTAAAGGAAAGAGG - Exonic
944712465 2:202347127-202347149 TTGTCCCAGCTGGAGTGCAGTGG - Intergenic
944767498 2:202879458-202879480 CTGCCCAGGCTGGAGCACAGTGG + Exonic
946210316 2:218142598-218142620 TTGTCCCAGCTGGAGTGCAGTGG - Intergenic
946218607 2:218206442-218206464 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
946358522 2:219204783-219204805 GTTATCCAGCTGAAGCACAGTGG + Intronic
947583584 2:231337335-231337357 TTGTCCCAGCTGGAGTGCAGTGG + Intronic
947592427 2:231393333-231393355 CTGGCCCAGCTGCCCCACAGGGG + Intergenic
948442903 2:238007991-238008013 TTGCCCAGGCTGAAGCACAGTGG + Intronic
948956923 2:241300245-241300267 CTGGCCCAGATGGAGCACCGGGG - Intronic
1168792854 20:591679-591701 GTCTCCCAGCTGAAGTGCAGTGG + Intergenic
1170471705 20:16674411-16674433 CTGTCCCAGCTGATGCTGAGTGG + Intergenic
1171492076 20:25526988-25527010 CTGCCCAGGCTGAAGAACAGTGG - Intronic
1171892221 20:30727078-30727100 CTGTCCAAGCTGGAGTGCAGTGG + Intergenic
1172198296 20:33107162-33107184 TTGCCCCAGCTGGAGCGCAGAGG - Intronic
1172369392 20:34376313-34376335 TTGTCCCAGCTGAAGTGCAAGGG + Intronic
1172377057 20:34452028-34452050 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1172733577 20:37109146-37109168 TTGCCCAAGTTGAAGCACAGTGG - Intronic
1172856004 20:38002998-38003020 CTGTCCAAGCTGGAGTACAGTGG + Intronic
1173877622 20:46384912-46384934 CCGTCCAAGCTGGAGCGCAGTGG - Intronic
1174087771 20:48021185-48021207 CTCTCTCAGCTGGAGCACAGGGG + Intergenic
1174262441 20:49306367-49306389 TTGTCCAGGCTGAAGCACAGTGG - Intergenic
1174383862 20:50174919-50174941 TTGTCCAAGCTGGAGTACAGTGG + Intergenic
1174640270 20:52037576-52037598 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
1174698700 20:52586091-52586113 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1174859283 20:54075243-54075265 CTGTCTCAGCTGGAGCAGGGTGG - Intergenic
1174920778 20:54699667-54699689 CTGCCCCAGCTGATGCTGAGTGG + Intergenic
1175159901 20:57000485-57000507 CTGTGCGACCTGAAGCCCAGAGG + Intergenic
1175994622 20:62806610-62806632 AGGTCCCAGCTGGAGCTCAGCGG + Intronic
1176235665 20:64052413-64052435 CTGTCCAAGCTGAGGGAGAGGGG - Intronic
1176388928 21:6153738-6153760 GTGTCCCAGCCGAGGCCCAGAGG + Intergenic
1176853912 21:13947240-13947262 CTGTCCAGGCTGAAGTACAGTGG + Intergenic
1176905679 21:14497550-14497572 CTGTCCCGGGTGGAGCGCAGCGG - Intronic
1177720043 21:24893868-24893890 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1179734544 21:43384510-43384532 GTGTCCCAGCCGAGGCCCAGAGG - Intergenic
1180480128 22:15746030-15746052 TTGTCCAAGCTGGAGTACAGTGG + Intergenic
1180814884 22:18783108-18783130 TTGTCCCAGCTGGAGTGCAGTGG + Intergenic
1180935211 22:19620868-19620890 CTCTCCCAGCAGAAGCGCATGGG + Intergenic
1181201073 22:21217443-21217465 TTGTCCCAGCTGGAGTGCAGTGG + Intronic
1181469486 22:23129000-23129022 CTGTCCCAGCTAAGCCACACAGG + Intronic
1181685807 22:24527314-24527336 TTGTCCAGGCTGGAGCACAGTGG - Intronic
1181700669 22:24619527-24619549 TTGTCCCAGCTGGAGTGCAGTGG - Intronic
1182607638 22:31518945-31518967 CTCTCCCAGCGGAATCACAAAGG - Intronic
1182760417 22:32718104-32718126 CTTTCCCAGCTGGAGCAGGGTGG + Intronic
1182941180 22:34279337-34279359 ATGTCCCAGCTCAAGCAATGAGG + Intergenic
1183295486 22:37026990-37027012 GTTTCCCAGCTGGAGTACAGTGG + Intronic
1183657648 22:39198180-39198202 TTGTCCAAGCTGGAGTACAGTGG + Intergenic
1183690408 22:39384854-39384876 TTGTCCAAGGTCAAGCACAGAGG + Exonic
1183763902 22:39852305-39852327 TTGTCCAGGCTGAAGTACAGTGG - Intronic
1184191700 22:42899324-42899346 TTGCCCAAGCTGAAGCGCAGTGG + Intronic
1184973058 22:48041190-48041212 CTGTCCCAGCAGCAGAAGAGGGG - Intergenic
1185388824 22:50548286-50548308 CTGTCCCCACTGAAGAAGAGGGG - Exonic
1203225843 22_KI270731v1_random:77985-78007 TTGTCCCAGCTGGAGTGCAGTGG - Intergenic
1203264985 22_KI270734v1_random:8799-8821 TTGTCCCAGCTGGAGTGCAGTGG + Intergenic
949568628 3:5269749-5269771 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
950350450 3:12345819-12345841 CTGTCACTGGTGAAGCACAGTGG - Intronic
950479683 3:13236708-13236730 GTGTCCCAGCCCTAGCACAGGGG - Intergenic
951075232 3:18383161-18383183 CTGTCCCTACTGGAGCACATGGG + Intronic
951097270 3:18646514-18646536 TTTTCCAAGTTGAAGCACAGAGG - Intergenic
951716368 3:25651823-25651845 TTGTCCAGGCTGAAGTACAGTGG - Intronic
951726204 3:25763083-25763105 CTGTCCAGGCTGTAGTACAGTGG - Intronic
952439975 3:33316939-33316961 TTGTCCAGGCTGAAGTACAGTGG + Intronic
952733908 3:36668974-36668996 ATGTCCCAGCTTAAAGACAGAGG + Intergenic
953551484 3:43907018-43907040 AAGGCCCAGCTGAAGCAGAGAGG + Intergenic
953883400 3:46702770-46702792 CTGTCCCTGCTGTTGCCCAGAGG + Intronic
954173650 3:48825602-48825624 TTGTCCAGGCTGGAGCACAGTGG - Intronic
954206589 3:49063752-49063774 TTGTCCAAGCTGGAGTACAGTGG - Intronic
954628596 3:52036178-52036200 GTGCCCCAGCTGGAGGACAGGGG - Intergenic
955280378 3:57589226-57589248 TTGCCCAGGCTGAAGCACAGTGG - Intronic
955955011 3:64279890-64279912 TTGCCCCAGCTGAAGTGCAGTGG - Intronic
956416487 3:69036006-69036028 CTATCCCAGCAGAAACACAAAGG + Intronic
957462660 3:80541714-80541736 TTGCCCAGGCTGAAGCACAGTGG - Intergenic
958930018 3:100198422-100198444 CTGCCCAAGCTGGAGTACAGTGG - Intergenic
959932484 3:111999303-111999325 CTGGCCCAGCAGCAGCAAAGAGG - Exonic
960684146 3:120280256-120280278 CTCCCCCAGCTGAGGCAAAGTGG + Intronic
961407805 3:126694375-126694397 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
961514987 3:127426757-127426779 CTGTCCCAGCTGAGGGGGAGGGG + Intergenic
961532669 3:127548715-127548737 CTGCCCCGGCTGGAGCGCAGTGG - Intergenic
962833283 3:139162805-139162827 TTGTCTCAGGTGAGGCACAGAGG + Intronic
963516320 3:146313634-146313656 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
964704903 3:159607733-159607755 CTGTCCCAGCTACCTCACAGGGG - Intronic
964757012 3:160097561-160097583 GTGTCCCAGCTGGAGTGCAGTGG + Intergenic
964757050 3:160097821-160097843 GTGTCCCAGCTGGAGTGCAGTGG + Intergenic
965735019 3:171810463-171810485 CTGGCACAGCTGGAGCTCAGCGG + Exonic
965988969 3:174792179-174792201 CTGTCCAGGCTGGAGTACAGTGG - Intronic
966394859 3:179492287-179492309 CTTTCCTAGGGGAAGCACAGTGG - Intergenic
966899511 3:184470112-184470134 TTGCCCAAGCTGGAGCACAGTGG - Intronic
966907368 3:184537145-184537167 CTCTCCAGGCTGAAGTACAGTGG + Intronic
967249853 3:187526268-187526290 CTGCCCAAGCAGGAGCACAGTGG + Intergenic
968674240 4:1869078-1869100 TTGTCCTGGCTGAAGCGCAGTGG + Intergenic
968797846 4:2720609-2720631 TTGCCCAAGCTGGAGCACAGTGG - Intronic
969538662 4:7772129-7772151 CTGTTCCAGCCGAAACACCGTGG - Intronic
969677261 4:8620982-8621004 GGTTCCCAGCTGAAGCCCAGAGG + Intergenic
969678213 4:8626620-8626642 GGTTCCCAGCTGAAGCCCAGAGG + Intergenic
969679169 4:8632258-8632280 GGTTCCCAGCTGAAGCCCAGAGG + Intergenic
973233471 4:47869183-47869205 TTGGCCAAGCTGAAGTACAGTGG - Intronic
973548386 4:52005546-52005568 TTGCCCCAGCTGGAGTACAGTGG - Intronic
975287893 4:72641507-72641529 CTGGCCCAGATGAAGCAAAAAGG - Intergenic
975334747 4:73162897-73162919 TTGCCCAAGCTGAAGTACAGTGG + Intronic
976605205 4:86976182-86976204 CTTTCCATGCAGAAGCACAGAGG + Intronic
977417326 4:96749579-96749601 CTGTCCCAGCACAAGCCCAGAGG - Intergenic
977449430 4:97176296-97176318 CTTGCCCAGCTGAAGTGCAGTGG + Intergenic
977599648 4:98922514-98922536 TTGTCCCAGCTAGAGTACAGTGG - Intronic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
979123055 4:116927052-116927074 CTGTATTACCTGAAGCACAGGGG - Intergenic
979537221 4:121836997-121837019 TTGCCCAAGCTGAAGTACAGTGG + Intronic
979752350 4:124294768-124294790 CTGGCCCACCTGAATCAGAGAGG - Intergenic
980378667 4:131979868-131979890 GTGGCCCAGCTGAAGTGCAGTGG - Intergenic
980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG + Intergenic
981318766 4:143367762-143367784 TTGCCCCAGCTGAAGTGCAGTGG + Intronic
981442717 4:144801083-144801105 ATGTCCCAGATGAAGCAGTGAGG - Intergenic
981608723 4:146569297-146569319 ATGTCCCAGCTCAAGAAAAGAGG + Intergenic
982172472 4:152675115-152675137 CTGCCCAGGCTGGAGCACAGTGG - Intronic
982243302 4:153322369-153322391 TTGTCCCAGCTGGAGTGCAGTGG - Intronic
982270187 4:153578325-153578347 CTGCCCAGGCTGAAGCACAGTGG - Intronic
982570729 4:157048115-157048137 CTGTCTCAGCTGAAGAAAATTGG + Intergenic
982854411 4:160362700-160362722 CTGTCCCATCAAAAGCCCAGAGG - Intergenic
983191673 4:164760698-164760720 CTGTCCAGGCTGGAGCATAGTGG - Intergenic
983554127 4:169044927-169044949 CACTCCCAGCTGAAGCCAAGTGG - Intergenic
983891255 4:173032643-173032665 TTGCCCAGGCTGAAGCACAGTGG - Intronic
984623163 4:181976157-181976179 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
984679154 4:182587128-182587150 TTGCCCAGGCTGAAGCACAGTGG + Intronic
985869489 5:2542822-2542844 CTGTCCCAGCTCTGGGACAGCGG - Intergenic
986082418 5:4408676-4408698 TGGTCCCAGCTGAAGCAGATAGG - Intergenic
988282452 5:29167627-29167649 CTCTCTCTGCTGCAGCACAGAGG + Intergenic
989643477 5:43604709-43604731 TTGTCCAAGCTGGAGTACAGTGG + Intronic
990365270 5:55064190-55064212 TTGCCCCAACTGAAGCACAAAGG - Intergenic
990900931 5:60748080-60748102 TTGCCCCAGCTGGAGCACAGTGG - Intergenic
992734369 5:79704049-79704071 CTGCCCAAGCTGAAGTGCAGTGG - Intronic
993238346 5:85345149-85345171 TTGTCCAGGCTGAAGCACAGTGG - Intergenic
995093185 5:108204948-108204970 TTGCCCAAGCTGGAGCACAGTGG + Intronic
995618047 5:113989246-113989268 CTGCCCAGGCTGGAGCACAGTGG - Intergenic
995706865 5:114995916-114995938 ATTTCCCAACTGAAGCATAGTGG + Intergenic
995971922 5:117983102-117983124 CTGTCCTAGAGGAGGCACAGTGG + Intergenic
996071093 5:119132635-119132657 TTGCCCCAGCTGGAGTACAGTGG - Intronic
996193632 5:120576646-120576668 CTGTCCCAGCTCAAGCAGCCAGG - Intronic
996328526 5:122304319-122304341 TTGTCCCGGCTGGAGTACAGTGG - Intergenic
996437267 5:123448722-123448744 ATGTCCAGGCTGGAGCACAGTGG + Intergenic
997955957 5:138278804-138278826 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
998526120 5:142844813-142844835 TTGTCCCAGCTGTAGTGCAGTGG - Intronic
998864024 5:146476749-146476771 CTATCTCATCTGAAGAACAGAGG - Intronic
998981747 5:147711705-147711727 TTGCCCCAGCTGGAGTACAGTGG + Intronic
1000466613 5:161586556-161586578 CTGGCCAGGCTGGAGCACAGTGG - Intronic
1001066648 5:168540192-168540214 CTGCCCAGGCTGAAGTACAGTGG + Intergenic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1002293111 5:178213014-178213036 TTGTCCAGGCTGAAGCACATTGG + Exonic
1002679965 5:180953683-180953705 CTGTTCCAGAACAAGCACAGTGG - Intergenic
1002716483 5:181231263-181231285 CTGCCCCAGCTTAAACACACTGG - Intronic
1002915142 6:1522958-1522980 TTGCCCCAGCTGGAGCACAGTGG - Intergenic
1003046690 6:2739992-2740014 CTGTTCAAGCTGAATCACTGGGG - Intronic
1003294862 6:4816865-4816887 CTGTCTCAGCTAAAACACATAGG - Intronic
1003311445 6:4972854-4972876 TTGGCCCAGCTGAAGTGCAGTGG - Intergenic
1003614450 6:7642451-7642473 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
1005443812 6:25900068-25900090 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1005465584 6:26109339-26109361 CTGTTCCAGTAGAAGCTCAGGGG - Intergenic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1006279697 6:33040688-33040710 TAGTCCCAGCTGAAGGACTGAGG - Intergenic
1006477695 6:34268315-34268337 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1006526733 6:34612373-34612395 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1006658479 6:35618406-35618428 TTGTCCAGGCTGAAGCACAATGG + Intronic
1007034215 6:38658128-38658150 GCCTCCCAGCTGAAGTACAGTGG + Intergenic
1007572697 6:42904641-42904663 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
1007704737 6:43783788-43783810 CTACTCCAGCTGAAGCAAAGGGG - Intronic
1007733469 6:43965869-43965891 CTGTCCAAGCTGCAGCAGATTGG - Intergenic
1008636680 6:53417820-53417842 TTGTCCCAGCTGGAGTGCAGTGG - Intergenic
1009718987 6:67440279-67440301 CTTTCCAGGCTGGAGCACAGTGG + Intergenic
1010467449 6:76185496-76185518 TTGTCCCAGCTGAAGTGCAGTGG - Intergenic
1010467698 6:76188378-76188400 TTGTCCCAGCTGAAATGCAGTGG - Intergenic
1012281518 6:97332889-97332911 TTGCCCAAGCTGGAGCACAGCGG - Intergenic
1012440529 6:99257987-99258009 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1012846439 6:104395454-104395476 CTGTCCCAGCCCAAGAACAGAGG - Intergenic
1012950377 6:105512085-105512107 TTGCCCCAGCTGGAGTACAGTGG + Intergenic
1013057428 6:106597382-106597404 CTGTCCAGGCTGAAGTGCAGTGG + Intronic
1013430571 6:110051561-110051583 ATGTCCCAGCTTAAGCAGAGAGG - Intergenic
1013840013 6:114380401-114380423 CTGACCAGGCTGGAGCACAGTGG + Intergenic
1013859421 6:114617119-114617141 CTGTTCTAGATGAAGCATAGTGG + Intergenic
1014645704 6:123969787-123969809 CTCTCCCAGCTCCAGGACAGAGG - Intronic
1014765722 6:125404049-125404071 TGGTCCAAGCTGGAGCACAGTGG + Intergenic
1015368700 6:132425968-132425990 TTGCCCCAGCTGGAGTACAGTGG + Intergenic
1015457288 6:133441178-133441200 TTATCCAAACTGAAGCACAGAGG - Intronic
1016495423 6:144656449-144656471 TTGCCCCAGCTGGAGCGCAGTGG + Intronic
1016720616 6:147292787-147292809 CTGGAACAGGTGAAGCACAGAGG - Intronic
1017786297 6:157759905-157759927 GTTTCCCAGCTGGAGTACAGTGG + Intronic
1017928401 6:158930540-158930562 CTGTTCCAGCTGGAGTGCAGTGG + Intergenic
1019556598 7:1634535-1634557 CTCACTCAGCTGAAGCACACAGG - Intergenic
1019611733 7:1940178-1940200 CCTTCCCAGGAGAAGCACAGAGG - Intronic
1019697510 7:2454202-2454224 TTGCCCAGGCTGAAGCACAGTGG - Intergenic
1020063767 7:5171910-5171932 GTGTCCAGGCTGAAGTACAGTGG + Intergenic
1020121008 7:5503390-5503412 TTGTCCAGGCTGGAGCACAGTGG + Intronic
1020498123 7:8882219-8882241 CTGTCCCAGCTGATACTGAGTGG + Intergenic
1020893957 7:13916596-13916618 CTGTCACAGCTGGAGTGCAGTGG - Intronic
1021293630 7:18876740-18876762 TTGTCCAGGCTGGAGCACAGTGG + Intronic
1021321648 7:19219995-19220017 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
1021481150 7:21118643-21118665 CTTTCCCAGCTGAAGTCCAAAGG - Intergenic
1021551470 7:21875619-21875641 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1022576072 7:31498263-31498285 CTGCCCCAGCTGGAGTACAATGG - Intergenic
1022713213 7:32872633-32872655 TTGTCCAGGCTGCAGCACAGTGG - Intronic
1023133315 7:37025594-37025616 ATGTCCCAGCTCAAGCAGTGAGG - Intronic
1023493172 7:40766248-40766270 TTGTCCCAGCTGGAGTGCAGTGG + Intronic
1023573559 7:41599336-41599358 TTGCCCAAGCTGAAGCGCAGTGG - Intergenic
1026200767 7:68212786-68212808 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
1026954256 7:74366834-74366856 CTGCCCAGGCTGAAGCGCAGTGG - Intronic
1027345040 7:77251059-77251081 CTGTCCAGGCTGGAGTACAGTGG + Intronic
1027436310 7:78168193-78168215 TTGCCCAAGCTGAAGTACAGTGG + Intronic
1028224367 7:88232672-88232694 CTGCCCAGGCTGAAGCGCAGTGG - Intergenic
1028401332 7:90428930-90428952 CTGTCCAGGCTGGAGTACAGTGG + Intronic
1028415816 7:90579596-90579618 CTGTCCAGGCTGAAGTGCAGTGG + Intronic
1028474808 7:91241506-91241528 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1028559509 7:92158314-92158336 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1029162001 7:98559198-98559220 TTGCCCCAGCTGGAGTACAGTGG + Intergenic
1029179394 7:98689043-98689065 TGTTCCCAGCTGAAACACAGAGG + Intergenic
1029681620 7:102115360-102115382 GTGTCCCTGCAGCAGCACAGAGG - Intronic
1029698239 7:102228756-102228778 TTGTCCAGGCTGAAGTACAGTGG - Intronic
1030402503 7:109069933-109069955 TTATCCCATCTGAACCACAGAGG - Intergenic
1030406332 7:109118794-109118816 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1031861605 7:126986049-126986071 TTGTCCCAGCTGGAGTCCAGTGG + Intronic
1032268232 7:130383118-130383140 CTGTCCGAGCAGCAGAACAGGGG + Intronic
1032577593 7:133072128-133072150 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1033177776 7:139141290-139141312 TTGTCCAAGCTGGAGTACAGTGG + Intronic
1033304798 7:140217063-140217085 TTGCCCAAGCTGAAGTACAGTGG - Intergenic
1033496547 7:141902980-141903002 ATGTCCCAGCTCAAGCAATGAGG + Intergenic
1033736634 7:144228936-144228958 CTTTGCCAGCTGACTCACAGAGG + Intergenic
1033746422 7:144322014-144322036 CTTTGCCAGCTGACTCACAGAGG - Intergenic
1034412056 7:150947003-150947025 CTGTAGCAGCTGCAGGACAGTGG + Exonic
1035695484 8:1592420-1592442 CTTTCCAAGCAGAAACACAGGGG - Intronic
1035748915 8:1981706-1981728 GTGTCCCAGCTCCAGGACAGGGG - Intronic
1036688556 8:10927232-10927254 ATGCTCCAGCTGAAGCACCGAGG + Intronic
1037034971 8:14154931-14154953 CTGTCTCAGCTGTCGCCCAGTGG + Intronic
1038371410 8:26995519-26995541 TTGTCCCAGCTGGAGTGCAGTGG - Intergenic
1038976960 8:32709457-32709479 TTGCCCCAGCTGGAGTACAGTGG + Intronic
1039831006 8:41214806-41214828 TTGTCCAAGCTGAAGTGCAGTGG + Intergenic
1039854090 8:41397810-41397832 CTGTTCCTGGGGAAGCACAGAGG - Intergenic
1040470101 8:47729756-47729778 CTGTCCAGGCTAGAGCACAGTGG + Intronic
1040745424 8:50635782-50635804 TTGTACCAGCTCAACCACAGGGG - Intronic
1041086344 8:54260018-54260040 CAGCCCCAGCTGTAACACAGTGG - Intergenic
1041442729 8:57914961-57914983 CTCTGCCAGCTGAAGCAGAAAGG + Intergenic
1041668259 8:60467004-60467026 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1041799507 8:61784002-61784024 ATGTCCCAGCTGAAGCAGTGAGG + Intergenic
1042045583 8:64647670-64647692 ATGTCCCAGCTGAAACAGTGAGG + Intronic
1042060870 8:64815973-64815995 TTGGCCCAGCTGACCCACAGCGG - Intergenic
1042288134 8:67137019-67137041 TTGCCCAAGCTGAAGTACAGTGG + Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044240034 8:89877937-89877959 CTGTCCCGGCTGGAGTGCAGTGG - Intergenic
1044875088 8:96657303-96657325 TTGCCCCAGCTGAAGTGCAGTGG - Intronic
1045220410 8:100193419-100193441 CTGCCCCGGCTGGAGTACAGTGG - Intronic
1047876611 8:129145095-129145117 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
1048289242 8:133167648-133167670 CTGTCCCAGCTGATGCCACGTGG - Intergenic
1048678522 8:136812443-136812465 CTGTACCAGCTGGAGGACATGGG + Intergenic
1048978509 8:139689680-139689702 CTGCCCAAGCTGGAGCGCAGTGG + Intronic
1049111442 8:140646787-140646809 CTGCGCCAGCTAATGCACAGAGG + Intergenic
1050312178 9:4364810-4364832 TTGACCAGGCTGAAGCACAGCGG + Intergenic
1050346652 9:4695531-4695553 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1051063433 9:13072838-13072860 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1051282455 9:15455912-15455934 TTGTCCCAGCTGGAGTGCAGTGG + Intronic
1051284789 9:15484685-15484707 TTGCCCCAGCTGAAGTGCAGTGG - Intronic
1051609430 9:18946940-18946962 CTATCCAATCTGAAGAACAGAGG + Intronic
1051775586 9:20629691-20629713 ATTTCCCAGCTGGAGTACAGTGG + Intergenic
1051969914 9:22876272-22876294 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1052844663 9:33324509-33324531 CTTGCCCACCTGAAGCGCAGTGG - Intronic
1052928334 9:34036847-34036869 CTGCCCAGGCTGGAGCACAGTGG + Intronic
1053431638 9:38045569-38045591 TTGTCCAGGCTGAAGCGCAGTGG - Intronic
1054356599 9:64068636-64068658 CTGTCCAAGCTGGAGTGCAGTGG - Intergenic
1054986138 9:71263817-71263839 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1055997994 9:82182501-82182523 TCGCCCAAGCTGAAGCACAGAGG - Intergenic
1056809594 9:89753971-89753993 CTGTCCCAGTTGACCCACACTGG - Intergenic
1056964198 9:91152456-91152478 ATGTCCCAGCTCAAGCATGGAGG + Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057421759 9:94918461-94918483 CTGTGCCAGCTCAAGCCCATGGG - Intronic
1057516691 9:95728330-95728352 CTGCCGCTGCTGACGCACAGTGG - Intergenic
1057849886 9:98557002-98557024 TTGCCCAAGCTGAAGTACAGTGG - Intronic
1058427797 9:104890539-104890561 TTGCCCCAGCTGGAGTACAGTGG - Intronic
1058707910 9:107652462-107652484 CAGACCAAGCTGAAGCAAAGGGG - Intergenic
1059319631 9:113458789-113458811 TTGTCCAGGCTGGAGCACAGTGG + Intronic
1060262331 9:122087247-122087269 TTATCCCAGCTGAAGTGCAGTGG + Intronic
1060370120 9:123061156-123061178 CTGCCCAGGCTGGAGCACAGTGG + Intronic
1060618676 9:125043658-125043680 TTGTCCAAGCTGGAGTACAGTGG + Intronic
1060669478 9:125457026-125457048 CTGTCCAGGCTGGAGTACAGTGG + Intronic
1060963237 9:127696294-127696316 TTGTCCCAGCTGGAGTGCAGTGG - Intronic
1061967475 9:134024380-134024402 TCGTCCCAGCTGAAGTGCAGTGG + Intergenic
1062525710 9:136977322-136977344 CTGCCCCAGCTGAGGCAGCGTGG - Intergenic
1203486271 Un_GL000224v1:58233-58255 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
1203498892 Un_KI270741v1:131-153 TTGTCCAGGCTGGAGCACAGTGG - Intergenic
1185489195 X:507894-507916 CTGCCCACGCTGGAGCACAGTGG + Intergenic
1185663896 X:1749198-1749220 CTGCCCATGCTGAAGCGCAGTGG + Intergenic
1185715397 X:2337986-2338008 TTGTCTCAGCTGAGGCACAGCGG - Intronic
1186309742 X:8304630-8304652 CTTTCCCAGCTGTAGCATAAAGG + Intergenic
1186419942 X:9417634-9417656 CTGCCCAGGCTGAAGTACAGTGG + Intergenic
1186539992 X:10390691-10390713 CTGACCCTGCTGAAGCCCAGAGG - Intergenic
1188374593 X:29412229-29412251 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1188419035 X:29973837-29973859 CTCTCCCAGTTGCAGCTCAGTGG - Intergenic
1188501759 X:30834658-30834680 CTGTCCAGGCTGGAGTACAGTGG + Intronic
1190180299 X:48185922-48185944 CTGTCCAAGCTGGAGTGCAGTGG - Intergenic
1190183845 X:48218280-48218302 CTGTCCAGGCTGAAGTGCAGGGG + Intronic
1192412680 X:70948433-70948455 TTGTCCAGGCTGAAGTACAGTGG + Intergenic
1193693692 X:84680539-84680561 CTGTTTCAGCTTAGGCACAGAGG + Intergenic
1194107471 X:89789316-89789338 TGGTCCCATCTGAAGCATAGTGG + Intergenic
1194595259 X:95848863-95848885 CTGACCCAGCAGAGTCACAGTGG + Intergenic
1195325864 X:103757863-103757885 CTGGCCCAGCTCAGCCACAGCGG + Intergenic
1196894582 X:120322266-120322288 TTTTCCCATCAGAAGCACAGAGG + Intergenic
1197186374 X:123591996-123592018 TTGTCCAGGCTGGAGCACAGTGG + Intergenic
1197473443 X:126891166-126891188 CTGTCCCATCACAGGCACAGAGG - Intergenic
1198450825 X:136766109-136766131 ATGCCTCAGCTGAAGCACAAGGG + Intronic
1199294935 X:146146451-146146473 CTGCCACAGCTGAAGGCCAGGGG - Intergenic
1200166454 X:154039008-154039030 CAGGCACAGCGGAAGCACAGGGG + Intronic
1200459430 Y:3437123-3437145 TGGTCCCATCTGAAGCATAGTGG + Intergenic
1201616606 Y:15907329-15907351 ATGTCCATGCTGTAGCACAGTGG - Intergenic
1201899095 Y:19028173-19028195 CTGCCCAGGCTGAAGTACAGTGG - Intergenic
1202123858 Y:21552118-21552140 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1202155150 Y:21877262-21877284 CTGCCCAGGCTGGAGCACAGTGG - Intergenic
1202160039 Y:21924375-21924397 CTGCCCAGGCTGGAGCACAGTGG - Intergenic