ID: 1113752502

View in Genome Browser
Species Human (GRCh38)
Location 13:112785986-112786008
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 5, 1: 2, 2: 0, 3: 6, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752502_1113752508 14 Left 1113752502 13:112785986-112786008 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752508 13:112786023-112786045 ACTGTGCTTTCCAGGTAATGCGG 0: 7
1: 0
2: 0
3: 24
4: 181
1113752502_1113752507 6 Left 1113752502 13:112785986-112786008 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752507 13:112786015-112786037 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752502 Original CRISPR GCCCGTCCACGCGTGTGCGT GGG (reversed) Intronic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
921262509 1:213396506-213396528 GGCCGTCCACACGTGTTCGGTGG - Intergenic
1062980477 10:1718330-1718352 GACCGTCCATGCATGTGGGTGGG - Intronic
1069591477 10:69644852-69644874 GCCCGGGCATGCTTGTGCGTGGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1105018501 12:132801122-132801144 GTCCGTCCAGGCCTGTGCCTCGG - Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1113752502 13:112785986-112786008 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752519 13:112786109-112786131 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752535 13:112786232-112786254 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752551 13:112786355-112786377 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752568 13:112786478-112786500 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752585 13:112786601-112786623 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752601 13:112786724-112786746 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1152034746 17:77865212-77865234 GTGCGCCCGCGCGTGTGCGTGGG - Intergenic
1160699222 19:498045-498067 GCCGGGACCCGCGTGTGCGTGGG + Exonic
1161978201 19:7617666-7617688 GCCCGCCCACACGTGGGAGTTGG + Intronic
1163717060 19:18878862-18878884 ACCCGTCCAAGCGTGTTCGTGGG - Exonic
1164668583 19:30059916-30059938 GCGCATCCACGCGTGGACGTGGG - Intergenic
1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG + Exonic
925288864 2:2733479-2733501 GCCCGCACACGCGTGTGCGGTGG - Intergenic
925288873 2:2733525-2733547 GCCTGCACACGCGTGTGCGGTGG - Intergenic
938336983 2:130509430-130509452 GCCCTTCCTCGGGTGGGCGTGGG - Exonic
938352858 2:130611316-130611338 GCCCTTCCTCGGGTGGGCGTGGG + Intergenic
1176178759 20:63740153-63740175 GTCGGTCCGCGCGTGTCCGTGGG + Intronic
1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG + Intergenic
1181230229 22:21417547-21417569 GCCCCTCACCTCGTGTGCGTCGG - Intronic
1181248420 22:21517316-21517338 GCCCCTCACCTCGTGTGCGTCGG + Intergenic
1181307886 22:21927304-21927326 GCGCCTTCACGCGTGTGTGTGGG - Intronic
1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG + Intronic
990992594 5:61700395-61700417 GCCTGGCCACGAGTGTGCGTGGG + Intronic
999536257 5:152520864-152520886 GCCCGTGCCCGCGTGTGTGTTGG + Intergenic
1002282112 5:178137196-178137218 GCCTGTCCTCGGGTGTGCGGCGG + Intronic
1018798352 6:167204139-167204161 GGCCGTCCACGCCTGGGCTTGGG - Intergenic
1018814362 6:167320037-167320059 GGCCGTCCACGCCTGGGCTTGGG + Intergenic
1022481491 7:30746218-30746240 GCACATGCACGCGTGTGGGTGGG - Intronic
1023818641 7:43968390-43968412 GCCCGGCCACGTGTGTGAGCGGG + Intergenic
1029743689 7:102505355-102505377 GCCCGGCCACGTGTGTGAGCGGG + Intronic
1029761676 7:102604518-102604540 GCCCGGCCACGTGTGTGAGCGGG + Intronic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1057305855 9:93911522-93911544 GCCCGTCCACCTGTGGGCGCGGG - Intergenic