ID: 1113752507

View in Genome Browser
Species Human (GRCh38)
Location 13:112786015-112786037
Sequence TGGGGTAAACTGTGCTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 7, 1: 0, 2: 1, 3: 14, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752498_1113752507 28 Left 1113752498 13:112785964-112785986 CCTTCAAAATGGATGAGCTAAAC 0: 7
1: 0
2: 2
3: 14
4: 193
Right 1113752507 13:112786015-112786037 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130
1113752503_1113752507 5 Left 1113752503 13:112785987-112786009 CCACGCACACGCGTGGACGGGCT 0: 5
1: 2
2: 0
3: 4
4: 23
Right 1113752507 13:112786015-112786037 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130
1113752502_1113752507 6 Left 1113752502 13:112785986-112786008 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752507 13:112786015-112786037 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752507 Original CRISPR TGGGGTAAACTGTGCTTTCC AGG Intronic