ID: 1113752508

View in Genome Browser
Species Human (GRCh38)
Location 13:112786023-112786045
Sequence ACTGTGCTTTCCAGGTAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 7, 1: 0, 2: 0, 3: 24, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752502_1113752508 14 Left 1113752502 13:112785986-112786008 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752508 13:112786023-112786045 ACTGTGCTTTCCAGGTAATGCGG 0: 7
1: 0
2: 0
3: 24
4: 181
1113752503_1113752508 13 Left 1113752503 13:112785987-112786009 CCACGCACACGCGTGGACGGGCT 0: 5
1: 2
2: 0
3: 4
4: 23
Right 1113752508 13:112786023-112786045 ACTGTGCTTTCCAGGTAATGCGG 0: 7
1: 0
2: 0
3: 24
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752508 Original CRISPR ACTGTGCTTTCCAGGTAATG CGG Intronic