ID: 1113752535

View in Genome Browser
Species Human (GRCh38)
Location 13:112786232-112786254
Sequence GCCCGTCCACGCGTGTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 5, 1: 2, 2: 0, 3: 6, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752535_1113752541 14 Left 1113752535 13:112786232-112786254 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752541 13:112786269-112786291 ACTGTGCTTTCCAGGTAATGCGG 0: 7
1: 0
2: 0
3: 24
4: 181
1113752535_1113752540 6 Left 1113752535 13:112786232-112786254 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752540 13:112786261-112786283 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752535 Original CRISPR GCCCGTCCACGCGTGTGCGT GGG (reversed) Intronic