ID: 1113752568

View in Genome Browser
Species Human (GRCh38)
Location 13:112786478-112786500
Sequence GCCCGTCCACGCGTGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 5, 2: 0, 3: 1, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752568_1113752573 6 Left 1113752568 13:112786478-112786500 CCCAGGCACACGCGTGGACGGGC 0: 2
1: 5
2: 0
3: 1
4: 58
Right 1113752573 13:112786507-112786529 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130
1113752568_1113752574 14 Left 1113752568 13:112786478-112786500 CCCAGGCACACGCGTGGACGGGC 0: 2
1: 5
2: 0
3: 1
4: 58
Right 1113752574 13:112786515-112786537 ACTGTGCTTTCCAGGTAATGCGG 0: 7
1: 0
2: 0
3: 24
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752568 Original CRISPR GCCCGTCCACGCGTGTGCCT GGG (reversed) Intronic
900666359 1:3817980-3818002 GCTCACACACGCGTGTGCCTGGG - Intronic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
907131693 1:52102995-52103017 GCCCTTCCAAGGGTGGGCCTTGG + Intergenic
907341457 1:53738820-53738842 GTCCGTCCCCGGGCGTGCCTCGG - Intergenic
914914623 1:151811548-151811570 GCGCGTGCATGTGTGTGCCTTGG + Intronic
1062836297 10:638067-638089 CCCCGGCCAGGTGTGTGCCTCGG + Intronic
1063828155 10:9921880-9921902 GCCCGTCCACGTATGTCTCTGGG - Intergenic
1066317306 10:34260483-34260505 GCCCATCCACATCTGTGCCTGGG - Intronic
1076857121 10:133122816-133122838 GCCTGGGGACGCGTGTGCCTGGG - Intronic
1076857125 10:133122832-133122854 GCCTGGGGACGCGTGTGCCTGGG - Intronic
1076857129 10:133122848-133122870 GCCTGGGGACGCGTGTGCCTGGG - Intronic
1084320039 11:68368202-68368224 CCCCCACCACACGTGTGCCTCGG - Intronic
1098769901 12:74539310-74539332 GCCAGTCCATGGGTGTGACTTGG + Exonic
1105014830 12:132780129-132780151 GTCTGTACACACGTGTGCCTGGG - Intronic
1105018501 12:132801122-132801144 GTCCGTCCAGGCCTGTGCCTCGG - Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG + Intronic
1111826690 13:93276585-93276607 TCCCGGCCACATGTGTGCCTGGG + Intronic
1113752502 13:112785986-112786008 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752519 13:112786109-112786131 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752535 13:112786232-112786254 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752551 13:112786355-112786377 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752568 13:112786478-112786500 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752585 13:112786601-112786623 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752601 13:112786724-112786746 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113782336 13:112983780-112983802 ACCCGTCCACCTGTGTGTCTGGG + Intronic
1127103298 15:55588436-55588458 GCCCGTCCCCGCGCGGGGCTGGG - Intronic
1130633187 15:85590100-85590122 CCCCGTCTATGTGTGTGCCTTGG + Intronic
1132646382 16:1001113-1001135 CACCGTCCACACGTCTGCCTGGG - Intergenic
1133233340 16:4376626-4376648 GCCCGTCCCCGCCTGACCCTGGG + Intronic
1133339646 16:5028076-5028098 GCCCGTCCACGCAGGTCCCGTGG + Exonic
1142566664 17:844460-844482 GCCCATCCACTCCTGTGGCTCGG + Intronic
1150416558 17:64993487-64993509 GCCCCTCCACGTGTGCCCCTTGG - Intergenic
1150795101 17:68230409-68230431 GCCCCTCCATGCGTGCCCCTTGG + Intergenic
1158954129 18:62523492-62523514 GCCCGGCCGCGCGTCCGCCTCGG - Exonic
1161410670 19:4115441-4115463 GCCAGTCCTCGTGTGTGCCAGGG - Intronic
1163151790 19:15419270-15419292 GCCCGACCATGCTTGGGCCTTGG - Intergenic
1163662824 19:18588906-18588928 GCCCGTTCCCGCTTGGGCCTGGG - Intronic
1163717060 19:18878862-18878884 ACCCGTCCAAGCGTGTTCGTGGG - Exonic
1168146288 19:54421414-54421436 GCCCGTCCAGGTGTGGGTCTGGG - Intronic
1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG + Exonic
925288864 2:2733479-2733501 GCCCGCACACGCGTGTGCGGTGG - Intergenic
931439536 2:62278429-62278451 GCCCTTGCACCAGTGTGCCTTGG + Intergenic
941029451 2:160493951-160493973 GCCCGTCCAACCGCGAGCCTGGG - Intergenic
1180085811 21:45507399-45507421 GCCCCTCCAAGCCTGTGCCAGGG - Intronic
1182446913 22:30395094-30395116 GCCCGTCCACACCTTGGCCTGGG + Intronic
1183485163 22:38084512-38084534 GCTAATCCACGCCTGTGCCTGGG + Intergenic
1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG + Intronic
1184332677 22:43835975-43835997 GCCCCTCCACGCTTTTCCCTGGG + Intronic
954108035 3:48419715-48419737 CCCCGTCCACTCGTCCGCCTCGG + Exonic
961453883 3:127014962-127014984 GCCCCTCCCCTCCTGTGCCTAGG + Intronic
968586599 4:1419839-1419861 AGCCGTCCATCCGTGTGCCTAGG + Intergenic
969582474 4:8073194-8073216 CCCCTACCACGCCTGTGCCTGGG - Intronic
985994140 5:3587288-3587310 TCCTGTCCACCTGTGTGCCTTGG - Intergenic
989600115 5:43192783-43192805 GCGCGTCCACACGTGAGCCGAGG + Intronic
990992594 5:61700395-61700417 GCCTGGCCACGAGTGTGCGTGGG + Intronic
999536257 5:152520864-152520886 GCCCGTGCCCGCGTGTGTGTTGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1018798352 6:167204139-167204161 GGCCGTCCACGCCTGGGCTTGGG - Intergenic
1018814362 6:167320037-167320059 GGCCGTCCACGCCTGGGCTTGGG + Intergenic
1049013021 8:139900194-139900216 GCCCGTGTGCGTGTGTGCCTGGG + Intronic
1049745575 8:144261823-144261845 GCCCCTCCAGTCGTGTGCCCAGG - Exonic
1056323393 9:85457776-85457798 GCCAGTCCACACCTGTGCCCAGG + Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic