ID: 1113752568

View in Genome Browser
Species Human (GRCh38)
Location 13:112786478-112786500
Sequence GCCCGTCCACGCGTGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 5, 2: 0, 3: 1, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752568_1113752573 6 Left 1113752568 13:112786478-112786500 CCCAGGCACACGCGTGGACGGGC 0: 2
1: 5
2: 0
3: 1
4: 58
Right 1113752573 13:112786507-112786529 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130
1113752568_1113752574 14 Left 1113752568 13:112786478-112786500 CCCAGGCACACGCGTGGACGGGC 0: 2
1: 5
2: 0
3: 1
4: 58
Right 1113752574 13:112786515-112786537 ACTGTGCTTTCCAGGTAATGCGG 0: 7
1: 0
2: 0
3: 24
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752568 Original CRISPR GCCCGTCCACGCGTGTGCCT GGG (reversed) Intronic